-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Clotilde Garrido, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Standard minimum inhibitory concentration broth microdilution assays in the presence of BSA/acetic acid were performed in triplicate as described in [65] using peptides chemically synthesised to ≥95% purity (Proteogenix). Dilution series are based on net peptide content ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Ons M’Saad, Joerg Bewersdorf,
bioRxiv - Cell Biology 2020
Quote:
... or 200 μM NHS ester-DY634 (Dyomics, catalog no. 634-01A), dissolved in 100 mM sodium bicarbonate (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Soohyun Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... The peptide was biotinylated on the N terminus via coupling with biotin-polyethylene glycol (PEG)4-propionic acid (ChemPep). Dry peptide resin was cleaved using 94% trifluoroacetic acid ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Elizabeth A. Kiffmeyer, et al.,
bioRxiv - Neuroscience 2022
Quote:
All mice were housed on a 12-hour light-dark cycle (7 a.m. - 7 p.m.) in open top mouse cages (Ancare, Bellmore, NY) in groups of 2-5 littermates per cage ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Jacinta Gahan, et al.,
bioRxiv - Microbiology 2021
Quote:
... Soil can contain up to 60% of its S as sulfate esters (Autry and Fitzgerald 1990) and the quantity of sulfatase enzyme used was calculated on this basis ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Ellen Busschers, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ascorbic acid free α-MEM (Caisson laboratories) supplemented with 10% FBS (Gibco) ...
-
No products found
because this supplier's products are not listed.
Zengqi Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fatty acid free BSA (Equitech-Bio, USA) was dissolved in FBS-free DMEM at room temperature according the ratio 1:100 (1 g fatty-acid free BSA ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Shisong Fang, et al.,
bioRxiv - Microbiology 2020
Quote:
... Salicylic acid was purchased from J&K Scientific Ltd ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
No products found
because this supplier's products are not listed.
Alexander E. Vlahos, et al.,
bioRxiv - Bioengineering 2020
Quote:
... mycophenolic acid (Myfortic, Novartis) and FTY-720 (fingolimod, Biorbyt). ALS was administered as a single i.p ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... isolated cells were incubated for 7 days in Teflon bags (VueLife 72C; Cellgenix, Freiburg, Germany) in VLE RPMI 1640 (Biochrome ...
-
No products found
because this supplier's products are not listed.
Enrico Radaelli, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 4-Hydroxynonenal (HNE, Alpha Diagnostic International HNE11-S ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 4 µg Cx36-SNAP and 4 µg V5-dGBP-TurboID using 50 µl Geneporter2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
Daniel Egert, et al.,
bioRxiv - Bioengineering 2020
Quote:
... blocked and incubated for 7-10 days at room temperature with both primary antibodies Rb ∝ mOR (ImmunoStar 24216) and Ms ∝ NeuN (Millipore MAB377) ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 12-port valves (IDEX, EZ1213-820-4) and a peristaltic pump (Gilson ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Bojana Radojevic, et al.,
bioRxiv - Cell Biology 2020
Quote:
Retinal organoids were fixed in 4% paraformaldehyde (FD neuroTechnologies) at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 50 nm gold particles (BBI Solutions, EM.GC50/4). Fixation was performed using a buffer made from ...
-
No products found
because this supplier's products are not listed.
Cerys S Manning, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Western blots were performed using 4-20% Tris-glycine acrylamide gels (NuSep), Whatman Protran nitrocellulose membrane (Sigma ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...