-
No products found
because this supplier's products are not listed.
Viren H. Makhijani, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 0.3% Triton X-100 for 2 hours before being incubated in rabbit anti-c-Fos antibody (1:4000 in 3% NGS + 0.1% Triton; Synaptic Systems, Goettingen, Germany; Lot# 226003/3-45) for 16 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
All bacteria were incubated anaerobically in the 24-well plate at 37°C for 3 hours in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Rachel C. Kelley, et al.,
bioRxiv - Physiology 2021
Quote:
... 10x objective lens) connected to a monochrome camera (Axio MRm, 1x c-mount, 2/3” sensor) and Zen Pro software (Carl Zeiss Microscopy). We used semi-automatic muscle analysis using segmentation of histology (SMASH ...
-
No products found
because this supplier's products are not listed.
Sherif Rashad, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... dissolved in pyridine (TCI, Tokyo, Japan) was added to the lyophilized sample ...
-
No products found
because this supplier's products are not listed.
Alison Besse, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C in a TC-7 roller drum (New Brunswick) at 240 rpm for 16 h ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Soohyun Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2× HEPES-buffered saline (pH 7, 500 μL, Alfa Aesar) was added dropwise to the mixture followed by 2.5 M CaCl2 (100 μL) ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Jonathan Lautz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and maintained at room temperature for > 1.5 h before recording (34⁰ C; 2-3 ml/min perfusion; Olympus BX-51WI microscope ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 × 105 Huh-7 cells were grown in a 35 mm dish (ibidi) with growth medium ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Alexander S. Zhovmer, et al.,
bioRxiv - Biophysics 2023
Quote:
Equimolar mixture of 3-amino-2-fluorobenzotrifluoride (Combi-Blocks, Cat#QA-4188) and 2,6-dichloro-4-isocyanatopyridine (Toronto Research Chemicals, cat#159178-03-7) were stirred and heated in anhydrous Toluene at 85°C overnight ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Peter Fabian, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Immunohistochemistry for dsRed was performed with a 7 minute −20°C 100% acetone target retrieval and blocking in 2% normal goat serum (Jackson ImmunoResearch, cat. no. 005-000-121). Primary antibodies include rabbit anti-mCherry (1:100 ...
-
No products found
because this supplier's products are not listed.
Benjamin J LaFrance, et al.,
bioRxiv - Biophysics 2021
Quote:
... it was placed inside the incubator at 30°C and after 2-3 minutes imaged with a 100x oil-immersion objective (Nikon CFI SR Apo, NA = 1.49) for 20 minutes at 1 frame/5 s with 300 ms exposure times for both MT seeds (using 640 nm laser excitation ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Anna Riccio, et al.,
bioRxiv - Microbiology 2022
Quote:
... and the C-terminal c-Myc-tagged pCMV3-2019-nCoV-NP-Myc (SARS-2 N) vectors were obtained from Sino Biological. The SARS-CoV-2 variants C-terminal Flag-tagged pReceiver-M39 U.K ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Hailong Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
JAK inhibitors pyridine-6 (BioVision, Cat No. 2534) and ruxolitinib (NCB018424 ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Melissa Govender, et al.,
bioRxiv - Immunology 2022
Quote:
... followed by 2 hours of incubation at 37°C with biotinylated anti-human IFN-γ monoclonal antibodies (clone 7-B6-1, Mabtech) diluted at 1μg/ml in PBS ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Sahil Nagpal, et al.,
bioRxiv - Biophysics 2023
Quote:
U-2 OS and COS-7 cells were obtained from American Type Culture Collection, Manassas ...
-
No products found
because this supplier's products are not listed.
Shuntaro Morikawa, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Fluorescence for cell viability and luminescence for caspase-3/7 activity was measured using Infinite M1000 plate reader (Tecan). Caspase-3/7 activity was normalized to cell viability according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Jieyu Zhao, et al.,
bioRxiv - Genomics 2022
Quote:
... into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research, R1016). Before the reverse transcription (RT) ...
-
Cystatin-C ELISA / assay Kit
Cat# K012-H1,
1.0 ea, USD $385.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ulschan Bathe, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
100 µL pyridine and 100 µL MSTFA (Macherey-Nagel) were added to dried yeast extracts and incubated for 2 h at 70 °C.
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Sinan Arslan, et al.,
bioRxiv - Genomics 2022
Quote:
... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
No products found
because this supplier's products are not listed.
Talia Hatkevich, et al.,
bioRxiv - Genetics 2020
Quote:
Antibodies for C(3)G (25) and g-H2Av (Rockland) were used ...
-
No products found
because this supplier's products are not listed.
Peter A. Summers, et al.,
bioRxiv - Biophysics 2020
Quote:
... Oligonucleotides (c-Myc and ds26; sequences = 5’-TGAGGGTGGGTAGGGTGGGTAA-3’ and 5’-CAATCGGATCGAATTCGATCCGATTG-3’, respectively) were purchased from Eurogentec, and dissolved in 10 mM lithium cacodylate buffer at pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Heidi Hempel Sullivan, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
No products found
because this supplier's products are not listed.
Matthias Fellner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Caspase 3-like activity was measured fluorometrically by the addition of 50 µM acetyl-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin (Ac-DEVD-AMC) at 37 °C in 96-well plates using a ClarioSTAR microplate reader (BMG LABTECH). The production of AMC (λEM = 390 nm ...
-
No products found
because this supplier's products are not listed.
S. Bayraktar, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Glomeruli were then cultured for 7 days at 37°C in the presence of 5% CO2 in Petri dishes (145/20 mm, Cell Star; Greiner Bio-One) coated with collagen I (Merck) ...
-
No products found
because this supplier's products are not listed.
Paulina Sosicka, et al.,
bioRxiv - Biochemistry 2021
Quote:
... resuspended in pyridine (Chem-Impex int’l Inc.), and analyzed with GC-MS ...
-
No products found
because this supplier's products are not listed.
Hsin-Hsiung Chen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... NRIP-C-ΔWD6/7 and NRIP-WD6/7) from bacteria were incubated with F-actin (AD99, Cytoskeleton) in the binding buffer (10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Jing Yang (John) Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 100 mM glycine to glow-discharged C-flat CF-2/2 C-T-grids (TED PELLA).
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Nicolas Daviaud, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Slides were then incubated overnight at 4°C with the following primary antibodies diluted in blocking solution: rabbit anti-cleaved caspase 3 (1:200, Novus Biologicals), rat anti-CTIP2 (1:500 ...