Labshake search
Citations for GenScript :
1 - 50 of 702 citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 St containing 2X-StrepTag at the C-terminal region was commercially synthesized as mentioned above (GenScript Biotech). SARS-CoV-2 N ...
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized cDNA encoding the SARS-CoV-2 S1 domain fused to the C-terminal portion of the VSV glycoprotein was obtained from Genscript. The cDNA was cloned into the XhoI and NheI sites of a modified recombinant VSV vector containing an additional transcription start stop signal between the G and L genes (Wirblich et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Biochemistry 2020Quote: ... and a C-terminal TAMRA label (N-AAARKKRRQRRR-C, Genscript), and MerMade-synthesized unlabeled HIV-1 TAR ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Pathology 2020Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after codon optimization for expression in human cells ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Flag ERβ (OHu25562D; pcDNA3.1+/C-(K) DYK were obtained from GenScript.
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Immunology 2023Quote: ... Synthetic MOTS-c peptide (GenScript) was reconstituted in sterile water and used at 10 µM.
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Cell Biology 2022Quote: ... or anti-c-Myc mAb (GenScript) were coupled with 50 µl beads and incubated with precleared proteins at 4°C for overnight with gentle mixing ...
-
bioRxiv - Cell Biology 2021Quote: ... Rabbit anti–c-Myc polyclonal (GenScript) and HRP-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... and C termini were synthesized (GenScript). Ligation-independent cloning following PCR amplification with appropriate primers and T4 DNA polymerase treatment was used to clone the sequences into pLIC6 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SpyTag peptide (N-term-AHIVMVDAYKPTKGSGDRCG-C-term, N-term: Acetylation, C-term: Amidation, purity: 94%, GenScript Biotech) was dissolved in triethanolamine (TEA ...
-
bioRxiv - Cancer Biology 2023Quote: ... to the N terminus of the DNase1L3 protein coding region and deleting the C-terminal DYK sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript), followed by insertion into the pmEGFP-N1 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... NM_032643.4) was cloned into the pcDNA3.1+/C-(K)-DYK vector with a C-terminal FLAG tag (GenScript). The cDNA of human STK25 isoform 1 (RefSeq accession no ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag (clone HPC4, Genscript), anti-E tag (clone 10B11 ...