-
No products found
because this supplier's products are not listed.
Katelyn A. Bustin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (Bullet Blender, BBY24M model, Next Advance, Inc., speed 8, 3 min, 4 °C), samples were diluted in PBS (500 μL ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... specimens were incubated with rabbit SARS CoV-2 spike (S) antibody (ProSci, USA, 1:200, 37°C for 2 h) or anti-SARS CoV-2 nucleocapsid (N ...
-
No products found
because this supplier's products are not listed.
Hiroe Suda, et al.,
bioRxiv - Plant Biology 2022
Quote:
... TSK gel ODS-100V (2 mm ID x 150 mm, 3 µm, Tosoh, Tokyo, Japan). The column was eluted with a linear gradient from 30 to 90% mobile phase B (0.1% formic acid in acetonitrile ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
V. Van Steenbergen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cells were treated with 0.05% Triton in GPEM buffer (3 min, 37°C) before incubation with MB11 (1:250, cat. number AG-27B-0009-C100 Adipogen) diluted in GPEM buffer supplemented with 2% BSA (15 min ...
-
No products found
because this supplier's products are not listed.
Stephen B. McHugh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were then incubated with primary antibodies diluted in 3% NDS blocking solution and incubated at 4 °C for 72 hours (GFP anti-chicken, 1:1,000, Aves Labs, catalog no ...
-
No products found
because this supplier's products are not listed.
Flavio R. Palma, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... for 2 h at 4 °C and finally stained with anti-8-oxo-dG (Trevigen, #4354-MC-050), followed by incubation with secondary antibody Alexa647 (Invitrogen #A28181) ...
-
No products found
because this supplier's products are not listed.
Bhagyashree Deshmukh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 2 mM PMSF) at parameters of 3 sec ON/ 5 sec OFF/ 60% amplitude (Probe sonicator Thomas Scientific). The supernatant was separated by spinning at 12,000 RPM ...
-
No products found
because this supplier's products are not listed.
Daisy Precilla S, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Caspase-3 (Cat. No: E-EL-R0160) and BCL-2 (Cat. No: E-EL-H0114) ELISA kits were purchased from Elabscience Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Dhruva D. Dhavale, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The mix was incubated for 2 h at 37 °C with shaking (1000 rpm) in an Incu-Mixer MP2 (Catalog H6002 Benchmark Scientific). Samples were transferred to Multiscreen FB Filter plates (Catalog MSFBN6B50 ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Mayumi K. Holly, et al.,
bioRxiv - Microbiology 2020
Quote:
... C-reactive protein (MyBioSource). The optical density was read at 450 nm on an EnVision plate reader (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Marta Fontcuberta-PiSunyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and C-peptide using a human C-peptide ELISA kit (Mercodia, Uppsala, Sweden).
-
No products found
because this supplier's products are not listed.
Kritika Khanna, et al.,
bioRxiv - Microbiology 2021
Quote:
... or BHK-21/WI-2 (Kerafast) cells were transfected with SARS-CoV-2 Spike expression plasmid (pTT5 SARS-CoV-2 SΔ21) ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
Cat# SC22000,
Coupling buffer+ Washing buffer + EDC, USD $76.00/KIT
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Irène Barbarin-Bocahu, Marc Graille,
bioRxiv - Biochemistry 2021
Quote:
Crystallization trials were performed by mixing 150 nL of protein with an equal volume of different crystallization solutions in 96-well TTP Labtech plates at 7°C using the Mosquito automate (TTP Labtech). Prior to X-ray exposure ...
-
No products found
because this supplier's products are not listed.
Jacob J. Kennedy, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 μm and a trap (IntegraFrit™ Capillary, 100 μm ID × 2 cm, New Objective) packed with Magic C18 AQ ...
-
No products found
because this supplier's products are not listed.
Anne Rix, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... followed by donkey F(ab’)2 anti-rabbit IgG (H+L)-Cy3 (3 μg/mL) (Dianova) [26] ...
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
GelMA C combines GelMA with nanofibrillated cellulose, which is jointly patented by UPM-Kymmene...
Cat# IKG5L3000303,
3 mL, USD $360.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... Ubiquitination assays were performed at 37 °C for 90 minutes using loaded E1 (~ 80 ng, 3 μl, Boston Biochem kit, K-995), E2 (1 μM ...
-
No products found
because this supplier's products are not listed.
Francisco del Caño-Ochoa, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 ml of heat-inactivated FBS were dialyzed against 1 L of tap water for 1 day at 4°C using SpectraPor #3 dialysis tubing with a molecular weight cutoff of 3,500 Da (Spectrum Laboratories, Inc., USA), supplemented with NaCl (9 g per liter) ...
-
No products found
because this supplier's products are not listed.
Yukitoshi Izumi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Finasteride (CAS#:98319-26-7) was from Steraloids (Newport RI).
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Jan J Lyczakowski, et al.,
bioRxiv - Plant Biology 2021
Quote:
... or in vitro reaction products were digested with Neocallimastix patriciarum GH11 enzyme overnight at 30 °C by amending the suspension with 2 μL of enzyme stock (Megazyme). These conditions achieved complete digestion of accessible xylan to xylose ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Alexandre Prola, et al.,
bioRxiv - Physiology 2024
Quote:
... anterior hindlimb compartments of 2/3-months-old C57BL6/J mice were injected with adeno-associated virus serotype 9 (AAV9 – Vector Biolabs) carrying either transgenes for STIM1 (AAV9-CMV-mStim1-2A-eGFP ...
-
No products found
because this supplier's products are not listed.
Liang Xu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A hole (2-3 mm diameter) on the skull surface was made by a high-speed microdrill (Microdrill 78001, RWD Life Science) and then covered with a coverslip (Warner ...
-
2 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C2-1.5H-N,
48/case, $219.00
Ask
Sandrine B. Lavenus, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 mL was cured overnight at 37 °C in each well of a 6-well glass bottom plate (Cellvis, Mountain View, CA). Using a biopsy punch (cat no ...
-
No products found
because this supplier's products are not listed.
Florian J. Bock, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S63845 (Chemgood, C-1370), Sytox Green (Thermo ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Yongtao Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Using 7550-1-C ceramic blades (Campden Instruments Limited), the tissue was cut into 250 μm slices at an advance speed of 0.1 mm/s ...
-
No products found
because this supplier's products are not listed.
Etai Sapoznik, et al.,
bioRxiv - Biophysics 2020
Quote:
... #1.5 coverslips (0420-0323-2, Bioptechs) were washed at room temperature in solution consisting of 1:1 (vol/vol ...