-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
D.K. Wilton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and a micromanipulator MM33 (Pipette.com 3-000-024-R). Mice were subsequently allowed to recover on a warm plate before being transferred back to their home cage ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mounted on B3-3 magnetic bases (Mitegen, GB-B3-R). MicroRT tubing (Mitegen ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Mariano A. Ostuni, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 glycerol and with 5 Critical Micellar Concentration of CALX173ACE (CALIXAR). CALX173ACE solubilized CX3CL1 was loaded into magnetic beads previously crosslinked to polyclonal anti-CX3CL1 antibody using an IP kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Erika Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5 μL of each dilution was plated on CHROMagar™ O157 plates (Drg International Inc). The plates were incubated at 30 °C for 24 h ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% of the KH-103 in Captisol/DMSO was formulated in 20% Solutol (GLPBIO) in 0.9% sterile saline (Moltox) (w:v ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
William J Dower, et al.,
bioRxiv - Immunology 2023
Quote:
... for 5-10 min at 25°C and the reaction was stopped using STOP solution (Surmodics Cat# LSTP-1000-01).
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Jieye Lin, Guanhong Bu, Johan Unge, Tamir Gonen,
bioRxiv - Biochemistry 2024
Quote:
... 1 was purchased from Advanced ChemBlocks Inc.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... -C (1:500, AffinityImmuno, clone W6/32) were incubated in 250ul blocking buffer with neurons overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Taylor Russo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and rabbit polyclonal anti-glycosyslceramide (Glycobiotech #RAS_0010, 1:3,000). Primary antibody was detected with HRP-linked donkey anti–rabbit IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Hasna Maachi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 1 % (vol./vol.) human serum albumin (Celprogen, Torrance, CA) for 3 days in the presence of EdU (10 μM ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...