-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 4: (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (LysN3, Iris Biotech GmBH); 5 ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Maxence LANOIZELET, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
No products found
because this supplier's products are not listed.
Massar Alsamraae, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 4) slow-release 5-α-dihydrotestosterone pellet (DHT;12.5mg 21-day release; Innovative Research); 5 ...
-
No products found
because this supplier's products are not listed.
Leonardo M. Molina, et al.,
bioRxiv - Biochemistry 2023
Quote:
... or E-cadherin (1:100) (Biorbyt) antibodies ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-4 (786-254B; G-Biosciences), Trypsin-5 (EN-151 ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Jiyoon Lee, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Cells were passaged at ∼80% confluency (generally every 4-5 days) in medium containing 10 µM Y27632 (hereafter, Y; ROCK inhibitor that inhibits apoptosis, ReproCell). WA25 cells were passaged in clusters with 0.5 mM EDTA ...
-
No products found
because this supplier's products are not listed.
Kirsi Savijoki, et al.,
bioRxiv - Microbiology 2021
Quote:
... Rifampicin solution (TOKU-E) in water at a final concentration of 400 µg mL-1 corresponding to 64 x MIC (minimum inhibitory concentration ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... we measured commercially available Quantum™ FITC-5 MESF (7 μm, Catalog No. 555, lot 14609, Bangs Laboratories) and AccuCheck ERF Reference Particles Kit (3 μm ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Olga Puchta, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Microarray imaging was performed in an imaging buffer solution containing fluorophore DFHBI-1T ((Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1Himidazol-5(4 H)-one) (excitation = 472 nm, emission = 507 nm)) from Lucerna Technologies Cat ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Embryos are placed in pre-equilibrated (at least 4 h at 37°C, 5% O2, 5% CO2) CSCM-C medium (Irvine Scientific) covered with mineral oil (Irvine Scientific ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Winifred M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-hydroxybenzoic acid-d4 from CDN Isotopes, and sodium taurocholate-d5 from Toronto Research Chemicals through Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Zeynep Cakir, et al.,
bioRxiv - Neuroscience 2022
Quote:
Peptides were resuspended in 4% formic acid and 3% acetonitrile and directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 1.9 μm ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
John J. Cordoba, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and centrifuged at 20k ×g at 4 °C for 5 min prior to loading into standard-coated capillary tubes (NanoTemper, GmbH, Munich, Germany). Microscale thermophoresis data were collected on a Monolith NT.115 (NanoTemper ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Sarah Lockhead, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 4 mM L-glutamine (all from Gemini Bio-Products, #400-110). HEK 293T cells were obtained from ATCC (CRL-3216 ...
-
No products found
because this supplier's products are not listed.
Chloe C. Ence, et al.,
bioRxiv - Microbiology 2024
Quote:
... The cultures were incubated at 37°C with 5% CO2 and routinely checked for mycoplasma contamination using the e-Myco Plus kit from Intron Biotechnology. Human hepatocellular carcinoma cells (HepG2 ...
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Deniz Irvali, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were broken with zirconia beads 4 × 60 seconds at maximum speed in BeadBug homogenizer (Benchmark Scientific). After 15 minutes of centrifugation at maximum speed ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Hunt, et al.,
bioRxiv - Microbiology 2023
Quote:
... A 4 mm segment of sterile silicone tubing (0.64 mm O.D., 0.30 mm I.D., Braintree Scientific Inc.) was advanced into the bladder during inoculation and retained there for the duration of the study as done previously 47 ...