-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Candice B. Herber, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4’-trihydroxychalcone were obtained from INDOFINE Chemical Company (Hillsborough ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
Robert H. Utama, et al.,
bioRxiv - Bioengineering 2021
Quote:
4-arm PEG-maleimide (PEG-4MAL, MW 20 kDa, Biochempeg), bisthiol-PEG (MW 1 kDa ...
-
No products found
because this supplier's products are not listed.
Bettina M. Fuglerud, et al.,
bioRxiv - Genomics 2021
Quote:
... at 4 °C overnight in CHAPS immunoprecipitation buffer (Fivephoton Biochemicals). After washing in TBST ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Alexandra R. Willis, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next,1,000 animals were placed on 6 cm plates in 400 μl total volume of M9 containing 10% (v/v) 10X OP50-1 and 4% (v/v) 0.2 μm green fluorescent polystyrene beads (Degradex Phosphorex). Where spores were included for the 3 h time point ...
-
Carbohydrate
Cat# GMS0289S,
Inquiry
Ask
HJ Monzo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-SSEA-4 scFv was replaced with anti-GFP scFv (Creative Biolabs). The CMV promoter was replaced with EF-1α for optimal expression of long RNA encoding multiple gene products ...
-
No products found
because this supplier's products are not listed.
Zhengtang Qi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The membrane was blocked for 1 h at room temperature followed by incubation overnight at 4°C with primary antibodies including FAM132b (AVISCERA BIOSCIENCE), PI3K ...
-
No products found
because this supplier's products are not listed.
Aldo E. García-Guerrero, et al.,
bioRxiv - Microbiology 2024
Quote:
... Membranes were blocked at room temperature for 1 hour in 5% skim milk/PBS and probed overnight at 4°C with 1:1000 dilutions of rabbit anti-HSP60 (Novus NBP2-12734) and goat anti-GFP (Antibodies.com A121560) antibodies ...
-
No products found
because this supplier's products are not listed.
Nejla Ozirmak Lermi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
DNA methylation analysis of the MLH1 gene was performed on DNA from frozen tissue samples of 7 tumors and 3 normal tissue (duodenum and blood) samples using a targeted NGS assay (EpigenDx, Hopkinton, MA). In brief ...
-
No products found
because this supplier's products are not listed.
Emilie Pondeville, et al.,
bioRxiv - Genetics 2019
Quote:
... Hemocytes were incubated at 4°C overnight with a rat anti-mCD8 antibody (Ancell) diluted 1:100 or a rabbit anti-PPO2 (Fraiture ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Norbert Ha, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Feeder cells used were Drug Resistant 4 Mouse Embryonic Fibroblasts (DR4-MEF) (Applied StemCell; ASF-1002). Feeder-free ES cells were cultured on culture dishes pre-treated with 0.2 % gelatin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Vera Kovaleva, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cells were incubated overnight at +4°C with the following primary antibodies: anti-MANF rabbit pAb (Icosagen, 310-100), anti-IRE1α rabbit mAb (CST ...
-
No products found
because this supplier's products are not listed.
Paola Benaglio, et al.,
bioRxiv - Genomics 2020
Quote:
Peripheral blood mononuclear cells (PBMCs) from 10 individuals (4 females and 6 males) were purchased from HemaCare (Northridge, CA) and profiled for snATAC using 10x Genomics Chromium Single Cell ATAC Solution ...
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were incubated with or without hPF4 (20 μg/mL) and KKO (20 μg/mL) in buffer containing a final concentration of 4 μM phosphatidylcholine/phosphatidylserine (75:25, Diapharma) for 10 minutes at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Denatured lysates were separated by PAGE on 4%–12% Bis-Tris gradient gels along with Flash Protein Ladder (Gel Company FPL-008) using MOPS SDS NuPAGE Running Buffer (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Carlos Theodore Huerta, et al.,
bioRxiv - Bioengineering 2024
Quote:
... LacZ/Lentiviral vector plasmid and Luc2/Lentiviral vector plasmid were described previously.5 Human ICAM-1/Lentiviral vector was purchased from GenTarget Inc ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Kevin S. Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 μL of wounded cells was ejected from the guillotine device and the outlet tubing using a syringe pump (see details in Section 5.3) into 1 mL of the fixing solution in a 2 mL round-bottomed tube (111568, Globe Scientific) and incubated for 10 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Elena Martínez-Balsalobre, et al.,
bioRxiv - Genetics 2021
Quote:
... A 3-mm-diameter platinum plate electrode (CUY 650-P3 Tweezers, Protech International) localized the pulses to approximately the dorsal one-half of the fin ...
-
No products found
because this supplier's products are not listed.
Sangam Kandel, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples were tested for the SARS-CoV-2 using the Aptima® SARS-CoV-2 (Panther® System, Hologic, San Diego, CA) nucleic acid amplification assay ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Benjamin M. David, Paul A. Jensen,
bioRxiv - Systems Biology 2022
Quote:
... Samples were homogenized for 3 minutes in two 90 s intervals at 1600 rpm (OHAUS homogenizer), then heated at 65 °C for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Risa Kato, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... They were housed in standard cages (175 × 245 × 125 mm) containing approximately 3 mm grain-size corn cob bedding (“Shepherd’s Cob,” Shepherd Specialty Papers, USA) and nesting material (“Parumasu ¼,” Material Research Center Co. ...
-
No products found
because this supplier's products are not listed.
Kuohan Li, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 10% glycerol and 5 mM β-mercaptoethanol and lysed by a Panda Plus 2000 homogenizer (GEA Niro Soavi). The lysate was clarified by high-speed centrifugation at 20 000×g at 4°C for 40 min ...
-
No products found
because this supplier's products are not listed.
Sudeshna Saha, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5% CO2 and shaking at 200 rpm in presence or absence of 30 µM CMP-Neu5Ac (Nacalai USA. Inc.) until OD600 equivalent to 0.4– 0.5.
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Laura Martinez-Ruiz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Tumor pieces were digested using 5–10 mL of a 2.5 mg/mL Collagenase NB4 standard (S1745401 Nordmark Biochemicals, Uetersen, Germany) solution in PBS + 3 mM CaCl2 for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
No products found
because this supplier's products are not listed.
Kai-Ting Huang, et al.,
bioRxiv - Physiology 2024
Quote:
... IP3R2 (Antibody Research Corporation; 1:1000), IP3R3 (BD Transduction Laboratory ...
-
No products found
because this supplier's products are not listed.
John M. Thomas III, et al.,
bioRxiv - Pathology 2019
Quote:
Mounted sections of tissue were incubated in PBTB (sterile PBS + .01% Tween20 + 0.2% BSA) for 1 hour followed by incubation in 1:500 dilution of primary antibody (Arigo Biolaboratories, Taiwan) for either 1 hour at room temperature or overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Chaim Glück, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a glass pipette was inserted into the lumen of the MCA and 1 μL of thrombin (1 UI; HCT-0020, Haematologic Technologies Inc) was injected to induce in situ clot formation (Fig ...