-
No products found
because this supplier's products are not listed.
Michael Morgan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... We added 29 µM of the enzyme:peptide mixture to 1 mL of 30 µM Ub-AMC (7-amino-4- methylcoumarin) (Boston Biochem), for a final concentration of 200 nM DUBm ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were washed 3 times in PBS and incubated for 2 h with adequate secondary antibody (Dianova, Hamburg, Germany; Table 1) solution without Triton™-X-100 ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Weronika Czaban, Jim Rasmussen,
bioRxiv - Plant Biology 2019
Quote:
... ground plant material was extracted in a 1-ml extraction mixture of chloroform, methanol and water (1:3:1, v:v:v) in Sarstedts Eppendorf tubes (Sarstedt AG & Co, Nümbrecht, Germany). One metal bead (a 3-mm tungsten carbide bead ...
-
No products found
because this supplier's products are not listed.
Kawsar Hossain, et al.,
bioRxiv - Neuroscience 2024
Quote:
... incubated with EdU reaction solution (4 mM CuSO4, 4 µM Sulfo-Cyanine 3 Azide [Lumiprobe] ...
-
No products found
because this supplier's products are not listed.
Cambrian Y. Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 2 μM Cy3 azide (Click Chemistry Tools AZ119-1), and 100 mM ascorbic acid freshly prepared and diluted in Gomori buffer (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Jiah Kim, Nimish Khanna, Andrew S. Belmont,
bioRxiv - Cell Biology 2019
Quote:
Cells were plated on 35mm dishes with a #1 1/2 thickness glass coverslip bottom (MatTek, P35G-1.5-14-C) 48 hrs before imaging ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2’,7’-dichlorodihydrofluorescein diacetate (DCFDA, Cell Biolabs) were used for mitochondrial and intracellular ROS staining ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μl Detection Buffer 1 (CisBio) was immediately added to the reaction mixture ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marta Varela-Eirín, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1 ng/ml recombinant human fibroblast growth factor-2 (rhFGF-2; Immunotools) or in MesenPRO RS™ Medium supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin.
-
35 mm glass bottom dish with 4 chambers, 20mm microwell, #1 cover glass (0.13-0.16mm). Designed...
Cat# D35C4-20-1-N,
100/case, $184.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Kiwon Park, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... cells were incubated with the following primary antibodies overnight at 4°C for S9.6-HIV-1-IN_PLA: mouse anti-DNA–RNA hybrid S9.6 (1:250; Kerafast, ENH001) and rabbit anti-GFP (1:500 ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Biswarathan Ramani, et al.,
bioRxiv - Genomics 2023
Quote:
... 2: rabbit anti-tRFP (1:1,000 dilution, polyclonal, Evrogen, AB233). The following secondary antibodies were used ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Samuel S. Hinman, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were coated with 2 mL of 10 µg mL-1 human type 1 collagen (5007, Advanced Biomatrix) in 1× PBS (46-013-CM ...
-
No products found
because this supplier's products are not listed.
Casey J. Latario, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 4% sucrose (Fisher, BP220-1) in PBS (National Diagnostics, CL-253) fixative (following IACUC protocol #0002073(m15)) ...
-
No products found
because this supplier's products are not listed.
Carmelo Milioto, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
No products found
because this supplier's products are not listed.
Yoann G. Santin, et al.,
bioRxiv - Microbiology 2023
Quote:
... manually back blotted for 3-4 secondes and flash-frozen in liquid ethane using a CP-3 plunger (Gatan). Data were collected on a 300-kV CRYO ARM™ 300 (JEM-Z300FSC ...
-
No products found
because this supplier's products are not listed.
Caterina Di Sano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1% nonessential amino acids and 2□mM L‐glutamine (all from Euroclone) was used for culturing A549 and Colo 699.The cells were maintained in an incubator at 37□°C with a humidified atmosphere with 5% CO2and were maintained as adherent monolayers ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Michael D. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... or entire S2 domain of SARS-CoV-2 Wuhan-Hu-1 S (ACROBiosystems). Beads were resuspended in PBS + 0.05% BSA ...
-
No products found
because this supplier's products are not listed.
Argentinian AntiCovid Consortium, et al.,
bioRxiv - Biochemistry 2020
Quote:
... This culture was used to inoculate 3 L of LSM with 40 g L-1 glycerol (supplemented with 3.5 mL L-1 PTM1 and 3.5 ml L-1 biotin 0.02% w/v) in a 7-L BioFlo 115 bioreactor (New Brunswick Scientific; Edison, NJ), which was interfaced with Biocommand Bioprocessing software (New Brunswick Scientific ...
-
No products found
because this supplier's products are not listed.
Patrick Günther, et al.,
bioRxiv - Immunology 2019
Quote:
Whole blood or buffy coat was diluted in room temperature PBS (1:2 or 1:5, respectively) and layered onto polysuccrose solution (Pancoll; PAN Biotech, Germany) for the enrichment of mononuclear cells by density gradient centrifugation according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Angel Justiz Vaillant, Patrick E. Akpaka,
bioRxiv - Immunology 2020
Quote:
... The protein concentration of purified IgY (Ab-1 and Ab-3) was assessed by a commercially available ELISA kit (MyBiosource, Inc), which protocol was performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Akihiko Sakashita, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× penicillin/streptomycin and 0.055 mM β-mercaptoethanol in DMEM high glucose (4.5 g l-1)) containing 2i (1 µM PD0325901, LC Laboratories; and 3 µM CHIR99021, LC Laboratories) and LIF (1,300 U ml-1 ...
-
No products found
because this supplier's products are not listed.
Gemma Gou, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Brain tissue was homogenized by 30 strokes in 1-mL or 7-mL borosilicate Dounce homogenizers (glass-Teflon tissue grinder; Wheaton, Millville, NJ) depending on the volume of buffer required ...