-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 400μM 3-isobutyl-1-methylxanthine (IBMX; 2885842; BioGems) for two days then replaced by a supporting medium (SM) ...
-
No products found
because this supplier's products are not listed.
Francisco del Caño-Ochoa, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 ml of heat-inactivated FBS were dialyzed against 1 L of tap water for 1 day at 4°C using SpectraPor #3 dialysis tubing with a molecular weight cutoff of 3,500 Da (Spectrum Laboratories, Inc., USA), supplemented with NaCl (9 g per liter) ...
-
No products found
because this supplier's products are not listed.
Maxence LANOIZELET, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
No products found
because this supplier's products are not listed.
Jessica B. Sarthi, et al.,
bioRxiv - Physiology 2023
Quote:
... Mice were anesthetized with oxygen-delivered isoflurane (1-3%) at 1 L/min via a vaporizer (Braintree Scientific, Inc, Braintree, Mass). Mouse temperature was monitored by rectal probe and maintained at 37°C through automated warming using a controlled warming pad (ATCC 2000 ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
No products found
because this supplier's products are not listed.
James R. Occean, et al.,
bioRxiv - Genomics 2023
Quote:
... The sections were blocked for 1 h at room temperature with 2% normal goat serum (Vector Biolabs) then incubated with 2 µg/mL dilution 5hmC antibody (Active Motif ...
-
No products found
because this supplier's products are not listed.
Shahzad S. Khan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the other group (7 mice) received untreated diet (Research Diets D01060501) for 14 days and served as the control group ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Naba Al-Sari, et al.,
bioRxiv - Biophysics 2020
Quote:
... 1-Palmitoyl-2-Hydroxy-sn-Glycero-3-Phosphatidylcholine (LPC(16:0)) was purchased from Larodan and 1-hexadecyl-2-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (PC(16:0e/18:1(9Z))) ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
C Spourquet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Takahiro Mitani, et al.,
bioRxiv - Biophysics 2022
Quote:
... Monomeric actin (G-actin) was loaded onto a 1 × 7 cm desalting column (Toyopeal 40S-HW, TOSOH, Japan) equilibrated with 1 mM ATP pH 7.0 and 0.1 mM CaCl2 ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
Xiaoqin Zhan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 0.1 μg/ml MEK1 activated extracellular signal-regulated kinase 1 and 2 (pERK1/2) (SignalChem Biotech), 1 μM TTA-P2 (Alomone Labs) ...
-
No products found
because this supplier's products are not listed.
S. L. Fowler, et al.,
bioRxiv - Neuroscience 2023
Quote:
Pooled EV fractions 4–6 isolated from 0.8 g tissue were diluted 1:5 in PBS containing a 1:3 dilution of 10 nm gold-conjugated BSA (BBI solutions), applied to glow-discharged 2/2 μm holey carbon-coated 200-mesh gold grids (Quantifoil ...
-
No products found
because this supplier's products are not listed.
Jonathon A.B. Smith, et al.,
bioRxiv - Physiology 2024
Quote:
... and glucose uptake was measured in the same medium by adding 1 uL.mL-1 of 2-[1,2-3H]Deoxy-D-glucose (MT911, Moravek) and 10 μM unlabelled 2-Deoxy-D-glucose in for 15 min [32] ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Katelyn A. Bustin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (Bullet Blender, BBY24M model, Next Advance, Inc., speed 8, 3 min, 4 °C), samples were diluted in PBS (500 μL ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Yuqing Wang, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... female Lewis rats received a subcutaneous injection of 200□μl of a 1:1 emulsion of 2□mg/ml porcine type II collagen (20031, Chondrex, Redmond, WA) with incomplete Freund’s adjuvant at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Mikael G. Pezet, et al.,
bioRxiv - Cell Biology 2023
Quote:
... hPSCs were passaged every 3-4 days with Accutase (Innovative Cell Technologies, San Diego, CA) at least two times before differentiation ...
-
No products found
because this supplier's products are not listed.
Caroline Murawski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 2 µm S1818 (Microchem, 5000 rpm, baking at 100°C for 1 min). Patterns were developed for 40 – 50 s in MF319 (Microchem) ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Jacob J. Kennedy, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 μm and a trap (IntegraFrit™ Capillary, 100 μm ID × 2 cm, New Objective) packed with Magic C18 AQ ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Aarini Ghosh, et al.,
bioRxiv - Zoology 2023
Quote:
Scanning Electron microscope imaging of stridulatory teeth was done at 1–2 kV resolution using JSM-6100 (JEOL, Japan) in the Department of Sophisticated Analytical Instrumentation Facility ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...