-
No products found
because this supplier's products are not listed.
Darya Task, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1-octen-3-ol (Sigma CAS #3391-86-4), 2,3-butanedione (Sigma CAS #431-03-8) ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Uday Saxena, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
No products found
because this supplier's products are not listed.
Ruthellen H. Anderson, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1 mL saponification buffer containing 7% KOH in 92% ethanol with 10 ug/mL coprostan-3-ol (Abcam) was added to 900 μL cell lysate ...
-
No products found
because this supplier's products are not listed.
Christian Leveque, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Neurosensor 510 (7-(Diethylamino)-4-(4-methoxyphenyl)-2-oxo-2H-1-benzopyran-3-carboxaldehyde) was purchased from (Tocris).
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Martin S. C. Larke, et al.,
bioRxiv - Genomics 2019
Quote:
... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Jan-Kolja Strecker, et al.,
bioRxiv - Neuroscience 2022
Quote:
... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
No products found
because this supplier's products are not listed.
Kristina Reinmets, et al.,
bioRxiv - Physiology 2020
Quote:
... and 1-bromo-3-chloropropane (TCI America, Product # B0575), precipitated with isopropanol and treated with DNase I (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Jianing Song, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 7-Bromo-1-heptanol (H54762, Alfa Aesar), EZview™ Red anti-FLAG® M2 affinity gel (F2426 ...
-
No products found
because this supplier's products are not listed.
Asif Ali, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were grown to O.D 0.3-0.6 and incubated with non-fluorescent Halo tag ligand 7-bromo-1-heptanol (7BRO, 100μM, VWR #AAH54762) for 10 min to irreversibly mask all the pre-existing ribosomal proteins ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
anti-Dynamin 1/2/3-mouse (BD Science, 1:1000), anti-Pacsin2-Rabbit (Proteintech ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Esteban Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
No products found
because this supplier's products are not listed.
Franck Dumetz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Alison Dumont, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3/7 dye (4440, Sartorius, 1/1000) and/or propidium Iodide (PI ...
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Apurva A. Govande, et al.,
bioRxiv - Microbiology 2023
Quote:
... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Katalin Zboray, et al.,
bioRxiv - Molecular Biology 2023
Quote:
All VOCs were purchased from Sigma-Aldrich (except for (5Z)-octa-1,5-dien-3-ol from Toronto Research Chemicals) in the highest available purity ...
-
No products found
because this supplier's products are not listed.
Alissandra L. Hillis, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and 1:1000 NucView 488 Caspase-3/7 substrate (Biotium, 30029). Cells were treated with 10 µL of drug-containing media ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Sarah Schnabellehner, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Mouse VEGFR3 domains 1-4 and 4-7 were detected by probing with the polyclonal goat anti-mouse VEGFR3 antibody (R&D Systems, AF743, 1:1000) against the extracellular domain of VEGFR3 ...
-
No products found
because this supplier's products are not listed.
Els F Halff, et al.,
bioRxiv - Neuroscience 2020
Quote:
... followed by overnight incubation at 4°C with primary antibody diluted in blocking solution (1:1000 Rabbit-α-SV2A, Abcam ab32942, Cambridge, UK; 1:300 Mouse-α-Neuroligin1/2/3/4, Synaptic Systems 129211, Göttingen, Germany). Sections were then washed in PBS (3×10 min ...
-
No products found
because this supplier's products are not listed.
B. Vanderperre, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fixed 1 min with 4% paraformaldehyde and stained with 2% uranyl acetate (EMS, 22400-2) for 1 min ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Mai-Anh T. Vu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or Drd1-cre (Figures 1, 2, 7, Jackson labs, strain #030329) ages 11 to 24 weeks were injected with AAVs to express genetically encoded proteins for optical measurements and manipulations (see Supplementary Table 1) ...
-
Cat# HY-W013035-500 mg,
500 mg, USD $50.0
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Erica A. Birkholz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-7 µl of cells were deposited on R2/1 Cu 200 grids (Quantifoil) that had been glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device shortly before use ...
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Sergio Lembo, et al.,
bioRxiv - Biophysics 2023
Quote:
... The blot was blocked in 5% BSA in TBST and subsequently incubated with primary antibody (anti-mDia1, #20624-1-AP, Thermo Fischer Scientific, 1:1000, overnight at 4° C; GAPDH, #NB300-221, Novus Biologicals, 1:40.000, 1-2 hrs at RT). Secondary antibody staining was performed for 1 hour at RT in blocking solution (Donkey-Anti-Rabbit-HRP ...
-
No products found
because this supplier's products are not listed.
Christophe Royer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 3 to 4 week old CD-1 females (Charles River UK) were injected intraperitoneally with 5 IU of PMSG (Intervet ...