-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Charles B. Reilly, et al.,
bioRxiv - Microbiology 2024
Quote:
... B.1.617.2 (delta) and B.1.1.28 (gamma)) were obtained from Cellecta Inc and B.1.529 (omicron ...
-
No products found
because this supplier's products are not listed.
Anne-Cathrine Vogt, et al.,
bioRxiv - Immunology 2022
Quote:
Recombinant SARS-CoV-2 spike S1 B.1.1.529-Omicron RBD protein was purchased from (antibodies-online GmbH), recombinant SARS-CoV-2 Spike RBD and recombinant SARS-CoV-2 Spike RBD B.1.617.2 L452R T478K were purchased from R&D systems ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... supplemented with hygromycin B (PhytoTechnology Laboratories) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 2x gentamicin/amphotericin B (CELLnTEC, Bern, Switzerland) over night at 4 °C ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Ryoji Amamoto, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... chicken B-galactosidase (1:3000, Aves Labs, cat. #BGL1010), goat B-galactosidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
Cat# 263010-20-4,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Yu Ning, et al.,
bioRxiv - Microbiology 2020
Quote:
... Itraconazole (ITZ) and amphotericin B (Amp B) were purchased from LKT Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
Native Toxin
Cat# CDB-TDL-100,
100µg USD $1441.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
A.K. Sulit, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2/1/56 FAA), and Porphyromonas asaccharolytica (CC44 001F, and CC1/6 F2) using Bacterial Lipopolysaccharides (LPS) Extraction Kit (Alpha Diagnostic International, Catalog # 1000-100-LPS) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Sebastian Jusuf, et al.,
bioRxiv - Microbiology 2020
Quote:
... GBS (ATCC 12386) was grown in New Granada Media/Strep B Carrot Broth (Z40, Hardy Diagnostics) at 37°C for 48 to 72 hours until the broth turned a rich orange-red color ...
-
No products found
because this supplier's products are not listed.
Fabrice C. Bernard, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and a manual filter wheel equipped with standard Cy5.5 and ICG-B filter cubes (Chroma Technology). The electronic shutter was left open during continuous imaging sessions ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Cassandre Bedu-Ferrari, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5% H2 atmosphere (Coy Lab Products, USA) (Text S1) ...
-
No products found
because this supplier's products are not listed.
Etai Sapoznik, et al.,
bioRxiv - Biophysics 2020
Quote:
... #1.5 coverslips (0420-0323-2, Bioptechs) were washed at room temperature in solution consisting of 1:1 (vol/vol ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Lihong Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 2 mg monoclonal antibody to collagen II (Chondrex) in 50 ul of PBS was administered by intraperitoneal injection ...