-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
F.M. Elahi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Bb fragment of complement factor B (Quidel-Microvue, San Diego, CA), terminal complement complex C5b-C9 (Elabscience ...
-
No products found
because this supplier's products are not listed.
Ivan Vujkovic-Cvijin, et al.,
bioRxiv - Immunology 2021
Quote:
... Resulting suspensions were plated on YCFAC+B (Anaerobe Systems, #AS-677), MTGE (Anaerobe Systems ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... or B.1.1.529 (Omicron; GISAID ID: EPI_ISL_7358094.2) Spike proteins (21st Century Biochemicals). 106 peripheral blood mononuclear cells well were re-suspended in 100 µL of R10 media supplemented with CD49d monoclonal antibody (1 µg/mL ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Sebastian P.H. Speer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... b) the BisBas scale to assess dispositional inhibition and approach behavior (Carver & White, 1994), c ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
HEp-2 slides (Antibodies Incorporated) were used according to manufacturer’s protocol with serum diluted 1:50 in 2% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
T Feige, et al.,
bioRxiv - Cell Biology 2023
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2, Emfret Analytics) served as a platelet specific marker ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Tatsuaki Kurata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next day the plasmid was extracted from 3 mL of the culture using Favorprep Plasmid Extraction Mini Kit (Favorgen Biotech Corp.). 500 ng of the plasmid mix was again transformed into BW25113 carrying a toxin expression plasmid and let to recover as before ...