-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Hamid Keshmiri, et al.,
bioRxiv - Biophysics 2023
Quote:
... U2OS cells were treated with 10 µM trichostatin A (TSA) for 6h (AbMole M1753), 25 µM camptothecin for 1h (Sigma-Aldrich C9911) ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
WB,ELISA
Cat# A5287, SKU# A5287-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Alexander O. Bradley, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Pedro Aguilar-Garrido, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were selected by blasticidin (2 μg/mL) (AG Scientific, CA, USA, Cat# B-1247) and hygromycin (400 μg/mL ...
-
No products found
because this supplier's products are not listed.
Nadine Kluser, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 1 % Pen/Strep and 5 ng/ml basic fibroblast growth factor (b-FGF, Fitzgerald Industries, Acton, USA) and were seeded in T300 tissue culture flasks (TPP ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... B.1.351 (Beta; Cube Biotech # 28721), P.1 (Gamma ...
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
Joshua A. Broussard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse U100 anti-desmocollin 1a/b (Progen, 65192); mouse anti-vinculin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... 500 μL single-cell suspensions were incubated at 37 °C for 6 h with 5% CO2 in 48-well plates in the presence of Cell Stimulation Cocktail (Tonbo Biosciences, #TNB-4975). Stimulated cells were stained with surface markers as described above ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... which were diluted 1:100 in triplicate into 5 mL fresh CHG media containing either 100 μM of the corresponding substrate (either LCA [Sigma] or 3-oxoLCA [Steraloids]). Cultures were grown for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Maciej M. Jankowski, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the outer panels of every third section contain two nose-poke ports (Fig 2; a total of 12 ports in 6 sections, SPECIAL.090-SE v1.0, LaFayette-Campden Instruments, Loughborough, UK). One of the two ports in each section is connected to a liquid pump and the other to a pellet dispenser ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Joyce Rigal, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... flies was extracted with TRI Reagent at 5 to 6 days and 30 to 31 days old according to the manufacturers protocol (Molecular Research Center, Inc., Cincinnati, OH). To generate RNA-seq libraries ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Lauren T. Que, Marie E. Morrow, Cynthia Wolberger,
bioRxiv - Biochemistry 2019
Quote:
... 5 (LifeSensors) FRET-K48 diubiquitin ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and maintained for 6 days in myoblast cell culture medium (SKM02, Amsbio). At day 12 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and p-SCN-Bn-TCMC (S-2-(4-Isothiocyanatobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra(2-carbamoylmethyl)cyclododecane) (catalog No. B-1005) were purchased from Macrocyclics, Inc ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Anna Stier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or Aurora B (SignalChem) kinases ...
-
No products found
because this supplier's products are not listed.
Brian J. Sanderson, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... All seeds were sown on autoclaved Gamborg’s B-5 Basal Salts (without sucrose) and Phytoblend agar (Caisson Laboratories, Inc., Smithfield, Utah, USA) and poured into sterilized petri dishes ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Gerrald A. Lodewijk, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... cells were seeded at 5,000-10,000 cells per cm2 and passaged every 2-3 days using Accutase (Innovative Cell Technologies, AT104).
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike (BPS Bioscience) and p24 (Abcam ...