-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ADP (0-5 μM; Bio/Data Corporation), collagen (0-50 μg/ml ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Lingling Yin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and SL/KAR treatment using 5 μM rac-GR24 (Chiralix, Nijmegen, The Netherlands). For ChIP-seq experiments ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Carbonyl Fe powder (5-9 μm) was purchased from STREM Chemicals (Newburyport, MA, USA). Fe2O3 nanopowders (50-200 nm ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... slides were incubated in 95% ethanol for 5 min and counterstained with Eosin (Poly Scientific S1761GL) for 1-3 min ...
-
No products found
because this supplier's products are not listed.
Scott C. Bolton, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the culture was supplemented with 10 mL (5%) Boost Production Additive (Expression Systems LLC, Davis, CA) where indicated ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).
-
No products found
because this supplier's products are not listed.
Inyup Paik, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A single colony was seed cultured overnight in 5 mL of superior broth (Athena Enzyme Systems, 0105). The next day ...
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
Aldosterone ELISA / assay Kit
Cat# K052-H5,
1.0 ea, USD $1285.0
Ask
Lara S. Hwa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 5 µl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays, Ann Arbor, MI), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Alexandra M. Amen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10-30% confluent U-251 cells were transduced at low MOI in 12-well plates with the lentivirus EF1a-BFP_Rsv-Bsd (5 µl; GenTarget, #LVP365) or EF1a-hTERT_Rsv-Bsd (50 µl ...
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Mason J. Appel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Colonies were picked manually (sublibraries 1 and 5 only) or using a PIXL robotic colony picker (Singer Instrument Company, Somerset, UK) at the Stanford University School of Medicine Genome Technology Center (Palo Alto ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Seung-Ho Lee, et al.,
bioRxiv - Microbiology 2021
Quote:
The viral genomic sequences were aligned and trimmed using the Clustal W tool in the Lasergene program version 5 (DNASTAR, USA), and multiple sequence alignment was performed with high accuracy and high throughput MUSCLE algorithms in MEGA 7.0 (53) ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
Methallyl alcohol is a chemical reagent.
Cat# abx186496-25G,
25 g USD $232.0
Ask
Daniel C. Levine, et al.,
bioRxiv - Neuroscience 2024
Quote:
... hypothalamus from PER2-TgWT mice that were fasted for 16 hours or given ad libitum access to HFD for 1 week was excised at ZT16 and extracted with ∼5 volumes of strong RIPA buffer containing kinase and phosphatase inhibitors (Abbexa abx090624), sonicated in a water bath 3 x 30sec on high ...
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Takanobu A. Katoh, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and with a single-mode fiber laser (wavelength of 1064Lnm; YLR-5-1064-LP-SF, IPG Photonics) and filter set (ZT1064rdc-sp, Chroma Technology, and SIX870, Asahi). A long-path filter was inserted before a halogen lamp (LV0630 ...