-
No products found
because this supplier's products are not listed.
Sébastien Durand, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were centrifugated during 10 min at 377g and fixed in an alcohol based fixative solution Thinprep® (Hologic) during 15 min ...
-
No products found
because this supplier's products are not listed.
Simranjit Sidhu, Benedikt Lauber,
bioRxiv - Neuroscience 2020
Quote:
... The skin was shaved and cleaned with alcohol swabs before surface EMG electrodes (Blue sensor P, Ambu, Bad Nauheim, Germany) were attached according to SENIAM guidelines with an inter-electrode distance of 2 cm ...
-
No products found
because this supplier's products are not listed.
Bikash Dangi, et al.,
bioRxiv - Biochemistry 2020
Quote:
The preparation of Human Liver Microsomes (HLM) obtained from 10 donors (mixed gender) with a history of chronic alcohol exposure (lot FVT) was purchased from BioIVT corporation (Baltimore ...
-
No products found
because this supplier's products are not listed.
Amarylis C.B.A. Wanschel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... NKX2-5 (orb-103103, Biorbyt).
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Tobie D. Lee, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... R-5 cells were incubated in a similar fashion except 5 μM pheophorbide A (PhA, Frontier Scientific, Logan, UT) was used as the substrate and 10 μM fumitremorgin C (FTC ...
-
No products found
because this supplier's products are not listed.
Shijian Zhang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... resuspended in 1×PBS to a final concentration of 5 mg of wet membrane per ml of 1×PBS and crosslinked with 5 mM BS3 (Proteochem), followed by solubilization with a solubilization buffer containing 100 mM (NH4)2SO4 ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
Cat# 2493-04-1,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Chloe R. Koulouris, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5% ethylene glycol and 20% PEG Smear Broad (Molecular Dimensions). This crystallisation condition differs from that reported in a recent crystal structure of holo SR (6SLH ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled A*0201 dextramer negative control (Immudex, 1:5). Antibodies for western blot ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which a 5 mL glass serum vial (DWK Life Sciences, New Jersey ...
-
No products found
because this supplier's products are not listed.
Raife Dilek Turan, et al.,
bioRxiv - Immunology 2021
Quote:
5 μg / ml of SARS-COV-2 Spike S1 Monoclonal Antibody (ElabScience) antibodies were added in the gel at a concentration of 2% ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Sumit J. Bandekar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ADGRL3 + GFP and TEN2 + dsRed and 5 μL LipoD293T (SL100668; SignaGen Laboratories). Two days after transfection ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific, cat.no. GR5MM). Counts of nucleated cells was performed using a NIHOKODEN auto blood cell counter under Pre-dilute 20 µl mode ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Geoffrey L. Rogers, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with either 5 µg/mL JR-CSF gp120 (Immune Technology) in coating buffer for samples ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Xiaoshan Shi, et al.,
bioRxiv - Biochemistry 2020
Quote:
100 nM purified ULK1 complex was mixed with 5 µM ULKtide (SignalChem Biotech Inc.), and incubated at room temperature for 1 h ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... zebrafish were incubated for 5 min at 28.5°C with optovin 6b8 (ID 5705191l; ChemBridge), an optovin analog (Kokel et al. ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The C57BL/6J females were superovulated following standard procedures with 5 IU PMSG (Genway Biotech, #GWB-2AE30A) followed 46 hours later with 5 IU hCG (Sigma ...
-
All viral vectors
Cat# KM30500,
ViroMag 100µL + ViroMag RL 100µL + AdenoMag 100µL, USD $235.75/KIT
Ask
Perrine Verdys, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 0.5 μM β-estradiol (Sigma-Aldrich #E2758)] and transduced with 1:5 (vol:vol) Thy1.1-expressing ER-HoxB8 retrovirus supernatant using Lentiblast Premium (OZ Biosciences). After one or two weeks ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Livio Dukaj, Nicholas Rhind,
bioRxiv - Cell Biology 2020
Quote:
... cultures were vacuum-filtered and cells were resuspended in fresh YPD supplemented with 5 µg/ml α-factor (Biomatik) and auxin to a final concentration of 500 µM ...
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... transfer of 1.5 mg per mouse of a 5 monoclonal anti-type II collagen (CII) antibody cocktail (Chondrex, USA). 3 days later ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...