-
No products found
because this supplier's products are not listed.
H. Ilmonen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by a DNA extraction with phenol:chloroform:isoamyl alcohol 25:24:1 (Amresco-inc, Solon, OH). Detection of PIK3CA c.3140A>G (p.H1047R) ...
-
No products found
because this supplier's products are not listed.
Pablo Vargas-Mejía, et al.,
bioRxiv - Plant Biology 2022
Quote:
... faded with 96% alcohol and processed after the addition of SynaptoRed C2 as stated by the manufacturer (Biotium, Fremont, CA, USA), following the methodology described by (55) ...
-
Cat# HY-N7107,
inquire
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Haspin inhibitor 5-Iodotubercidin (5-ITu) (MedChemExpress, IC50 value 5-9 nM ...
-
No products found
because this supplier's products are not listed.
Su-Juan Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
No products found
because this supplier's products are not listed.
Trisha A. Macrae, Miguel Ramalho-Santos,
bioRxiv - Molecular Biology 2020
Quote:
... 5 min total (Diagenode).
-
Coniferyl alcohol is an intermediate in biosynthesis of eugenol and of stilbene and coumarin.
Cat# S6429, SKU# S6429-5mg,
5mg, $137.00
Ask
Marc A. Vittoria, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5-10 µM (Selleck Chemicals); RACi ...
-
Two times crystallized. A suspension in 2.4 M ammonium sulfate containing 3% pyrophosphate and...
Cat# LS001089,
Bulk, Inquire
Ask
Rui Tang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5 mg Collagenase IV (Worthington), 25 U Dispase (Corning) ...
-
No products found
because this supplier's products are not listed.
Alexandros Sfikas, et al.,
bioRxiv - Cell Biology 2019
Quote:
... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The micropipette was bent to a desired degree by heating it over an alcohol lamp and was filled with phosphate-buffered saline (PBS) using the MicroFil (World Precision Instruments, MF34G-5). The micropipette was installed to a micropipette holder ...
-
No products found
because this supplier's products are not listed.
Maria Gabriela Otero, et al.,
bioRxiv - Neuroscience 2024
Quote:
... dehydration through graded alcohol and 100% acetone and embedment in Eponate (Ted Pella, Redding, CA). After at least 24 hours of polymerization at 56°C ...
-
No products found
because this supplier's products are not listed.
LM. Cardoso dos Santos, et al.,
bioRxiv - Pathology 2022
Quote:
... Slides were mounted in buffered polyvinyl alcohol (PVA) and images were taken using a fluorescence microscope (Axioskop 2, Carl Zeiss) equipped with a x20/1.4 objective and a high sensitivity ...
-
No products found
because this supplier's products are not listed.
Nicholas M. Timme, et al.,
bioRxiv - Neuroscience 2019
Quote:
This study utilized 12 male alcohol preferring (P) rats supplied by Indiana University School of Medicine and 12 male Wistar rats (Envigo, Indianapolis). All animals were born between November 22-26 ...
-
No products found
because this supplier's products are not listed.
Stephanie U. Greer, et al.,
bioRxiv - Genomics 2019
Quote:
... Embryos were cleared in 2:1 benzyl benzoate/benzyl alcohol solution and documented using an Olympus SZX12/DP71 imaging system (Olympus Corporation, Tokyo, Japan). RNA Reference Sequences deposited in ZFIN (RRID:SCR_002560 ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Caleb J. Rux, et al.,
bioRxiv - Physiology 2021
Quote:
... included 5-month (n = 5) and 22-month-old (n = 5) female C57Bl/6 mice from Charles River Laboratory ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Tarun Kumar, Leo Blondel, Cassandra G. Extavour,
bioRxiv - Developmental Biology 2020
Quote:
... 5 forceps (Fine Science Tools) and counted by counting the number of germaria under a ZEISS Stemi 305 compact stereo microscope with a NIGHTSEA stereo microscope UV Fluorescence adaptor.
-
No products found
because this supplier's products are not listed.
Jonathan Zorea, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and isoamyl alcohol (IAA) and then homogenized by bead-beating with bacterial disruption beads (RPI, 9833) for two cycles of 1 min each ...
-
No products found
because this supplier's products are not listed.
Chiara Bernardini, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Internal standards including fructose-13C6 (for sugars) and sorbitol-13C6 (for sugar alcohols) were obtained from Toronto Research Chemicals (Toronto, ON, Canada) and Sigma-Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Christoph Budjan, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and 0.05% poly-vinyl alcohol (PVA) were dispensed into 96-well U-bottom non-adherent suspension culture plates (Greiner Bio-One, 650185) and allowed to aggregate for 24 hours ...
-
No products found
because this supplier's products are not listed.
Angie M. Macias, et al.,
bioRxiv - Microbiology 2020
Quote:
... spores from archived (dried or alcohol-preserved) samples were mounted in hematoxylin for observation using a Nikon Eclipse E600 phase contrast light microscope (Nikon Instruments, New York) with “PH3” and “A” filters at 100x magnification ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Rainbow Calibration particles (RCP-60-5-2, RCP-60-5-5) were obtained from Spherotech. FITC and PE stained beads were part of the three color BD CaliBRITE kit (BD Biosciences 340486) ...
-
No products found
because this supplier's products are not listed.
Uriel López-Sánchez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... solubilized at 5 mg/mL in 5% DDM (Anatrace). After 30 minutes incubation ...
-
No products found
because this supplier's products are not listed.
Breane G. Budaitis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 mL DMSO (Cytoskeleton)] was added to the stock microtubule solution at room temperature.
-
No products found
because this supplier's products are not listed.
Alejandro Rodríguez Gama, et al.,
bioRxiv - Cell Biology 2022
Quote:
... PMA (BioVision, 1544-5), Dimerizer ligand (AP201870 ...
-
No products found
because this supplier's products are not listed.
Lisa C. Wellinger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5% CO2 (“The Brick”; iBidi). Using the cellSens software (Olympus) ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... QX-314 (5 mM, HelloBio) was added to the pipette solution.
-
No products found
because this supplier's products are not listed.
Lucia F. Zacchi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Two 5 L bioreactors (Sartorius) were seeded at 0.3 x 106 cells/mL in 3 L (total working volume ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5(6)-CTAMRA (Carbosynth/Novabiochem); TFA (Alfa Aesar) ...
-
No products found
because this supplier's products are not listed.
Laura Solforosi, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-5-Vio515 (Miltenyi Biotec), IL-4-PE Dazzle594 and IL-13-BV421 (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Eleanor Minogue, et al.,
bioRxiv - Immunology 2022
Quote:
... The product was detected by using an anti-5-Hydroxymethylcytosine antibody (5 nM, Active Motif), Eu-Protein A (5 nM ...
-
No products found
because this supplier's products are not listed.
Simona Miron, et al.,
bioRxiv - Biochemistry 2023
Quote:
... washed (5 × 5 min PBS-T) and scanned using Odyssey CLx imaging system (LI-COR).
-
No products found
because this supplier's products are not listed.
Amber F. Buhagiar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MCF10A cells were treated with 1 mM 5-ethynyl uridine (5-EU; Click Chemistry Tools 1261) for 1 h to label nascent RNA as in (Bryant et al ...
-
No products found
because this supplier's products are not listed.
Raquel Guillamat-Prats, et al.,
bioRxiv - Immunology 2021
Quote:
... Calcium 5 Assay Kit (Molecular devices) for 1 h at 37° C ...
-
No products found
because this supplier's products are not listed.
Geoffrey T. Norris, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 ug JES6-1 (BioXcell) intraperitoneally on days 2-4 post-infection in a total volume of 200 uL ...
-
No products found
because this supplier's products are not listed.
Shanlin Rao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% DOPS (Avanti Polar Lipids) was dried under a nitrogen stream and put under vacuum overnight ...
-
No products found
because this supplier's products are not listed.
Chloe Santos, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Tissues were dehydrated through an ascending alcohol series to Histoclear (National Diagnostics), embedded in 56°C paraffin wax ...
-
No products found
because this supplier's products are not listed.
Adam Taheraly, et al.,
bioRxiv - Microbiology 2023
Quote:
... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
No products found
because this supplier's products are not listed.
Valeria Lulla, Andrew E. Firth,
bioRxiv - Microbiology 2019
Quote:
... aminoguanidine (Cambridge Bioscience, 5 mM) and sodium L-ascorbate (Sigma ...
-
No products found
because this supplier's products are not listed.
Matteo Lunghi, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5% dialyzed FBS (Pan Biotech P30-2102 ...
-
No products found
because this supplier's products are not listed.
Bangmin Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the pTr1 cells (5×105 cells/5 ml/flask) were seeded in T25 flasks (83.3910.002; Sarstedt) in CM ...
-
No products found
because this supplier's products are not listed.
Margs S. Brennan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... p19/ARF (clone 5.C3.1, Rockland) and HSP70 (clone N6 ...
-
No products found
because this supplier's products are not listed.
Bingyi Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and Cal590 (5 μM, AAT Bioquest) were used for the indication of mitochondria ...
-
No products found
because this supplier's products are not listed.
Maiko Kawasaki, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... KRT1-5 (14309-1-AP ; Proteintech), Prdm16 (AF6295 ...
-
No products found
because this supplier's products are not listed.
T Krischuns, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Mohammad Haroon Qureshi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 5 mm tweezertrodes (BTX Harvard Apparatus). Embryos were placed back into the body cavity and allowed to grow for three days ...
-
No products found
because this supplier's products are not listed.
Marta Matuszewska, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a 5μL 5 HyperLadderTM 100bp (Bioline) to confirm product size ...