-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Kyra. J.E. Borgman, et al.,
bioRxiv - Immunology 2020
Quote:
... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
No products found
because this supplier's products are not listed.
Huamei Forsman, et al.,
bioRxiv - Immunology 2024
Quote:
... The HCA3R agonists IBC 293 (1-(1-Methylethyl)-1H-benzotriazole-5-carboxylic acid) and 3-hydroxy-octanoic acid (3-OH-C8) were from Tocris (Bristol, UK) and Cayman Chemical (Michigan ...
-
No products found
because this supplier's products are not listed.
Ethan W. Morgan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Indole-3-propionic acid and indole-3-lactic acid were from Alfa Aesar (Heysham, UK). AIN93G was purchased from Dyets ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... methyl ester (βARK1/GRK2 inhibitor; Cayman Chemicals, 24269-96-3), capadenoson (Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Sarah E Hancock, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... A 37-component fatty acid methyl ester standard (Merck Life Sciences) containing an additional 3.184 nmol of methyl nonadecanoate was concurrently subjected to the same derivatisation procedure and used as an external quality control for fatty acid identification by LC-MS ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Lea-Marie Jenster, et al.,
bioRxiv - Immunology 2022
Quote:
... bestatin methyl ester (Abcam), blasticidin (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Hao Hu, et al.,
bioRxiv - Plant Biology 2022
Quote:
An authentic standard of lesquerolic acid methyl ester was purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
No products found
because this supplier's products are not listed.
Sagnik Sen, et al.,
bioRxiv - Genomics 2024
Quote:
... 5-methyl-dCTP (NEB # N0356S), dATP ...
-
No products found
because this supplier's products are not listed.
Jason Sims, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Anurag Misra, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 µM [methyl-3H] SAM (PerkinElmer), 10 µM substrate RNA ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Tom Driedonks, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Mabel Kamweli Aworh, et al.,
bioRxiv - Microbiology 2023
Quote:
... Indole (BD BBL™, Sparks, MD) and oxidase (BD BBL™ ...
-
No products found
because this supplier's products are not listed.
Shuai Xu, Yafeng Kang, Zhiqiang Liu, Hang Shi,
bioRxiv - Biophysics 2022
Quote:
... except that the carboxylic silica beads were replaced by polystyrene carboxylic beads and polyclonal anti-digoxigenin from sheep (11333089001, ROCHE) were used in our experiments.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Junghyun L. Suh, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
The effect of DMSO and methyl ester version compounds (compound 34–38) on cell viability was determined using a CellTiter-GloTM ATP detection system (Promega #7573). For testing DMSO tolerance ...
-
No products found
because this supplier's products are not listed.
Qinyu Hao, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare) or Alexa FluorTM (AF ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Ugo Sardo, et al.,
bioRxiv - Physiology 2023
Quote:
... Membranes were blocked 1h with 5% of non-Fat dry milk (NFDM, Cell signaling) diluted in TBS-T buffer (10mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Carmen de Pablo, Sergio Casas-Tintó,
bioRxiv - Cancer Biology 2023
Quote:
... DNA was stained with 2-(4-amidinophenyl)-1H-indole-6-carboxami-Dine (DAPI) at 1 μM in Vectashield mounting media (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Melanie B. Abrams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
No products found
because this supplier's products are not listed.
Luke Vistain, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Jurkat cells were resuspended in 5 µM carboxyfluorescein diacetate succinimidyl ester (CFSE, Biolegend) in PBS for 20 min at room temperature in order to identify Jurkats specifically during cell sorting ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Wenjuan Yang, et al.,
bioRxiv - Immunology 2021
Quote:
... Caffeic acid phenethyl ester (CAPE) (R&D Systems), Mitoquinone (MitoQ ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Bibek Aryal, et al.,
bioRxiv - Plant Biology 2022
Quote:
... CLX or indole (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Eric Franklin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 20% methyl-5-norbornene-2,3-dicarboxylic anhydride and 2% catalyst dimethylbenzylamine (Electron Microscopy Sciences) over four days ...
-
No products found
because this supplier's products are not listed.
Abdel Rahman Abdel Fattah, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... organoids were treated from days 3 - 5 with ROCKi-free neural differentiation medium supplemented with retinoic acid (RA) (Stemcell Technologies) at 0.25 μM and smoothened agonist (SAG ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Angela C. Debruyne, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Poly(methyl methacrylate-co-methacrylic acid) (PMMA-MA; 10% methacrylic acid, MW ∼100,000 Da, 17913-500) was from Polysciences (USA), organic solvents were obtained from Carl Roth (Austria) ...
-
No products found
because this supplier's products are not listed.
Beichen Xie, et al.,
bioRxiv - Cell Biology 2021
Quote:
... was monitored by the lipophilic cationic dye tetramethylrhodamine methyl ester (TMRM) via fluorescence time-lapse imaging using an inverted microscope (Eclipse TE2000U; Nikon, Kanagawa, Japan). The epifluorescence microscope is equipped with a high-power LED light source (Omicron LedHUB ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... BML-P137) for 1h and 2h before reading fluorescence (ex 365, em 440) on a plate reader (Flexstation 3, Molecular Devices,). For cathepsin B activity assessment by microscopy ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Aniruddha Das, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A 3×5 mm2 craniotomy was drilled (Omnidrill35, World Precision Instruments) over an area covering the monocular and binocular primary visual (V1m and V1b ...
-
No products found
because this supplier's products are not listed.
Áron Kőszeghy, et al.,
bioRxiv - Neuroscience 2023
Quote:
3-5 months old male C57/BL6J mice (Charles River, UK) were anesthetized with isoflurane (4% induction ...
-
No products found
because this supplier's products are not listed.
Chen Qian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The UGT2B15 promoter 20 base-pair sequence (5’-TAACTTGATTGATTTTTCCT-3’ for wild type and 5’-TAACTTGGCTGTCTTTTCCT-3’ for mutant) was immobilized to a streptavidin SADH sensor chip (Sartorius) in running buffer (10 mM HEPES pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Maria Chechik, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The most concentrated fraction was spun for 5 min at 13K rpm before applying 3 µL to UltraAuFoil R1.2/1.3 gold support grids (Quantifoil). Prior to sample applications grids were glow-discharged for 3 min in Pelco easiGlow glow-discharger (Pelco ...
-
No products found
because this supplier's products are not listed.
Jingu Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... A cerebral microinfarction was induced for 3-5 seconds by 561nm laser illumination with 60X objective lens (LUMFLN60XW, NA 1.1, Olympus) after intravenous injection of 100μl Rose Bengal (15mg/ml ...