Labshake search
Citations for Bio-Rad :
1 - 50 of 2014 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 1h at room temperature with 5% Blotting-Grade Blocker (Bio-Rad, 1706404) in TBS-T buffer ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Evolutionary Biology 2021Quote: Urease detection test was carried out with urea-indole medium (BIORAD) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h-incubation with HRP-conjugated secondary antibodies diluted in 5% milk in TBST (anti-mouse HRP (BioRad, 1706516) 1:10000 ...
-
bioRxiv - Physiology 2021Quote: ... is used for calibration (Figure 1H Biorad #7318223 connected to tubing Picture 1C Tygon #R-3603) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Physiology 2021Quote: ... membranes were rinsed three-times in TBS/0.2% Tween for 10min and incubated for 1h with goat secondary anti-rabbit IgG linked to peroxidase (dilution 1:5 000, Biorad) in TBS/0.2% Tween/2% milk ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nitrocellulose membranes were blocked for 1h at RT in 5% Blotting Grade Blocker Non-Fat Dry Milk (Biorad, Hercules, CA, USA) and TBST ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Neuroscience 2024Quote: ... at room temperature for 1h for ECL chemiluminescence detection system (Bio-Rad) development ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cancer Biology 2024Quote: ... Trypsin was quenched with 12.5 µL formic acid (ULC-MS grade) and the beads were removed by filtration using a Bio-Spin column (BioRad, 400 g, 5 min), collecting the flow-through in a new 2 mL tube ...
-
bioRxiv - Genetics 2022Quote: ... 1h incubation at room temperature) and electrochemiluminescence detection (Clarity Max ECL; Bio-Rad). Membrane was eventually imaged using ChemiDoc MP imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... and migration was performed 1h at 170V in Tris-glycine buffer (Bio-rad) followed by Stain-Free gel activation using a ChemiDoc MP Imaging System (Bio-rad) ...
-
bioRxiv - Biophysics 2024Quote: ... the membranes were blocked for 1h in the EveryBlot blocking buffer (12010020, Biorad) and incubated overnight at 4°C with primary antibodies rabbit anti-Myf6 (sc-301 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... Nonspecific sites were saturated with a blocking solution for 1h (EveryBlot Blocking Buffer, BioRad). Membranes were incubated overnight at 4□°C with anti-CD9 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated 1h with HRP-conjugated secondary antibodies at 1:5,000 (Bio-Rad). After 4 more washes ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein transfer was performed at 110V for 1h onto 0.2 μm nitrocellulose membrane (Biorad). Membranes were stained in 0.2% Ponceau S (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ten micrograms of total RNA were separated on a 1% agarose gel containing 1X 3-(N-morpholino)propanesulfonic acid (MOPS) buffer and 2.2 M formaldehyde and transferred to a Zeta-probe membrane (Bio-Rad) by capillary transfer in 20X SSC buffer (3 M NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... folic acid 500 μg/L) or on Columbia agar solid support enriched with 5% horse blood (COH) (Biorad). Anoxic conditions were generated in Gaspack (BD ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies (Table 3) were diluted in 5% non-fat blocking milk (BioRad, Cressier, Switzerland) in TBST and incubated over night at 4°C with mild agitation ...
-
bioRxiv - Biochemistry 2024Quote: ... We ran the gels for 1h at 120 V with Tris/Glycine/SDS buffer (Biorad) and stained the gels with InstantBlue protein stain (Expedeon ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Genetics 2023Quote: ... The gels were run at 150V for 1h at room temperature in Tris·Glycine·SDS buffer (Bio-Rad) then transferred overnight at 4°C at 40mAmp to 0.22mm PVDF (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Cell Biology 2024Quote: ... After gel polymerization was performed pre-electrophoresis of empty gel in 5% acetic acid (running buffer) for 1-1.5h/150 V in reverse polarity of electrophoretic BioRad system (Bio-rad, USA). The running buffer was discarded ...
-
bioRxiv - Biochemistry 2024Quote: ... at 20V for 1h in a semi-dry Trans-Blot SD cell system (Bio-Rad, Hercules, CA). Following the blockade of the membranes using TBS-T (20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...