Labshake search
Citations for Lonza :
1 - 50 of 595 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Bioengineering 2023Quote: ... 1X (5 mL) non-essential amino acid (NEAA) mixture (Lonza, 13-114E), 1X (5 mL ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Microbiology 2024Quote: ... nonessential amino acids (Lonza), penicillin (100 IU/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), 10 percent heat-inactivated FBS (GE Healthcare Bio-Sciences) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10 percent heat-inactivated FBS (Hyclone) ...
-
bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10% heat-inactivated FBS (Hyclone).
-
bioRxiv - Microbiology 2020Quote: ... 1x nonessential amino acids (Lonza) and 20 µg ml-1 trypsin (Lonza) ...
-
bioRxiv - Molecular Biology 2022Quote: ... ascorbic acid (#CC-4116C, Lonza), bovine brain extract (#CC-4092C ...
-
bioRxiv - Physiology 2022Quote: ... ascorbic acid (CC-4116C, Lonza), bovine brain extract (CC-4092C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% 1xnonessential amino acids (Lonza), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (Lonza) and leukaemia inhibitory factor (1000 U/ml ...
-
bioRxiv - Immunology 2022Quote: ... amino acid (NEAA 100x Lonza) and Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Brachial and inguinal lymph nodes were digested for 1h at 37°C under shaking in R2 buffer (RPMI-1640 medium containing L-glutamine (Lonza) plus 2% fetal calf serum (Dutscher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (Lonza) and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... 1X non-essential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... non-essential amino acids (1X, Lonza), penicillin (100 IU/mL ...
-
bioRxiv - Microbiology 2022Quote: ... non-essential amino acids (1×, Lonza), penicillin (100 IU/mL) ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza) and 20 μg/ml N-tosyl-l-phenylalanine chloromethyl ketone (TPCK ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza). Vero-118 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... 1% non-essential amino acids (Lonza), 2mM L-glutamine (200mM ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... 1 × nucleic acid stain (GelStar, Lonza) was added to a 96 well qRT-PCR plate ...
-
bioRxiv - Genomics 2022Quote: ... 1X non-essential amino acids (Lonza), 1X Glutamax ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% Non-Essential Amino Acids (Lonza), 1% DMSO (PanBiotech ...
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Immunology 2021Quote: ... 100 μM non-essential amino acids (Lonza), 1 mM sodium pyruvate (VWR) ...
-
bioRxiv - Biophysics 2020Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 uM MEM nonessential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... 1X Non-essential Amino Acids (NEAA, Lonza), and 1x Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: ... R3-IGF-1 and Ascorbic Acid (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 1% nonessential amino acids (Lonza, Walkersville, MD), 1% penicillin/streptomycin (Cytiva ...
-
bioRxiv - Genomics 2020Quote: ... 1% non-essential amino acid solution (Lonza), and 1% antibiotic-antimycotic solution (Thermo Fisher Scientific ...