-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Linghao Hu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES, 10 μm, ASTATECH, A11656) was added to the cells in CM3 1 hour before imaging (35) ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Maximilian Donsbach, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the complementary 5’-phosphorylated oligonucleotides (AP-ICL top: 5’-GCA CCT TCC GCT CdUT CTT TC-3’ and AP-ICL bottom: CCC TGA AAG AAG AGC GGA AG) heated for 5 min at 95°C in 30 mM HEPES-KOH pH 7.0 ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Gerrald A. Lodewijk, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... cells were seeded at 5,000-10,000 cells per cm2 and passaged every 2-3 days using Accutase (Innovative Cell Technologies, AT104).
-
No products found
because this supplier's products are not listed.
Yi Sak Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
BV-2 microglia cell line was cultured in DMEM with 5% FBS and 50 μg/ml gentamicin (Omega Scientific) as described previously5 ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Liang Xu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A hole (2-3 mm diameter) on the skull surface was made by a high-speed microdrill (Microdrill 78001, RWD Life Science) and then covered with a coverslip (Warner ...
-
No products found
because this supplier's products are not listed.
Lin Lin, et al.,
bioRxiv - Microbiology 2022
Quote:
... mice infected with HN05 received a treatment of SU1498 (30 mg/kg; inhibitor of VEGFR-2; Catalog NO. 168835-82-3, AdooQ BioScience, US), DMOG (400mg/kg ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated by horizontal shaking (160 rpm) at 37°C in 8% CO2 for 2 days with addition of 5% Feed (Irvine Scientific) after 1 day ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
Alginate 5% is a viscous alginate hydrogel, suitable for both bioprinting and casting. You can...
Cat# IKA325000503,
5 mL, USD $220.0
Ask
Amber L. Altrieth, et al.,
bioRxiv - Cell Biology 2023
Quote:
Collagen hybridizing peptide (CHP) conjugated to 5-carboxyfluorescein (5-FAM) (Advanced BioMatrix) was solubilized per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Erick V. S. Motta, et al.,
bioRxiv - Microbiology 2024
Quote:
... All strains were initially cultured in Heart Infusion Agar (Criterion Inc, lot number: 491030) supplemented with 5% Defibrinated Sheep Blood (HemoStat Laboratories Inc, lot number: 663895-2) at 35 °C and 5% CO2 for 1 to 3 days ...
-
No products found
because this supplier's products are not listed.
Nicole M. Gaudelli, et al.,
bioRxiv - Genomics 2020
Quote:
... and 250IU/mL of recombinant human interleukin-2 (rhIL-2, CellGenix GmbH). Cells were activated with soluble human anti-CD3 (clone OKT3 ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Jing Wang, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 µM Ub (U-100H, Boston Biochem) and 5 µM UbcH7 (E2-640 ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Thomas M. Savage, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... CD4 APC (Tonbo Biosciences; clone RM4-5) and CD8 PE (Tonbo Biosciences ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike (BPS Bioscience) and p24 (Abcam ...
-
No products found
because this supplier's products are not listed.
Maria Alexandra Rujano, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Measures of fluorescence intensities over time (Fig. 5 and Supp. Fig. 5-1c) were performed on Volocity 6.3 (Quorum technologies). For each region (GFP only ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...