Labshake search
Citations for Avidity :
1 - 19 of 19 citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... pFN18a (Ig32)2-(R3IVVI)-(Ig32)2 was subcloned into a modified pFN18a vector engineered with the AviTagTM (Avidity) (sequence GLNDIFEAQKIEWHE) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... we biotinylated SARS-CoV-2 RBD using a terminal AviTag and BirA biotin ligase (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2021Quote: ... The captured SARS-CoV-2 protein was then biotinylated using the BIRA500 kit (∼2.5 μg per 10 nmol AVI substrate) (Avidity) and cleaved from the Fc purification tag concurrently with 200 μg of HRV3C prepared as described [42] ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 WT and Delta RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before(Robbiani et al. ...
-
bioRxiv - Immunology 2022Quote: ... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...