-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Changzheng Song, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (±)-GR24 (rac-GR24, CAS No: 76974-79-3) and Karrikin1 (KAR1, CAS No: 857054-02-5) were purchased from Chiralix (Nijmegen, Netherland). GR244DO was obtained from StrigoLab (Torino ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Sarah Stevens, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... thickness ≤ 0.4 cm) and extracted with 90 mL methanol in two 60 mL glass vials with polytetrafluoroethylene lined lids (DWK Life Sciences). Extraction was performed by sonication (Ultrasonic Cleaner USC-TH ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV 3CLpro complex with compound 5: Berkeley screen (Rigaku Reagents) condition B1 (30% (w/v ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2023
Quote:
Modified Hoagland’s solution imaging gels solidified with 5% Gelzan™ (Caisson Labs, UT, USA) were prepared for the root imaging experiments ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Cory Schwarz, et al.,
bioRxiv - Microbiology 2022
Quote:
... plus 5% defibrinated horse blood in fastidious anaerobe agar (FAA) (Neogen, Lansing, MI, United States). When growth was visible on the plates ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were switched to DMEM supplemented with 5% fetal bovine lipoprotein deficient serum (Alpha Diagnostic International), 100 U/ml penicillin and 100 μg/ml streptomycin ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Mathieu Richard, et al.,
bioRxiv - Biophysics 2019
Quote:
... glass coverslips were oxidized with an oxygen plasma for 3 min and incubated with 0.1 mg/ml Poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG; Jenkem Technology) in 10 mM HEPES at pH = 7.4 for 30 min ...
-
No products found
because this supplier's products are not listed.
Sujatha Muralidharan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A normal tissue TMA consisting of different organ specimens from 3 unique individuals was sourced from US Biomax (Cat# FDA999w1).
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...