-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Anamika Singh, Atul Narang,
bioRxiv - Bioengineering 2019
Quote:
... 14C-methanol (specific activity 57 mCi mmol−1) (American Radiolabeled Chemicals, Inc., St. Louis, Missouri, USA) at a final concentration of 2.7 mM was added to the culture (time t = 0 ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Colten D. Eberhard, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Tissues were weighed and homogenized in 500 μl 70% methanol using a bead mill (Beadbug Benchmark Scientific). Resulting supernatants were dried down by vacuum centrifugation (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Yang Chen, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... at 37°C for 20 minutes and developed for 3∼5 minutes at room temperature in the dark with freshly prepared DAB solution (Boster). The slides were observed under a microscope.
-
No products found
because this supplier's products are not listed.
Adar Sonn-Segev, et al.,
bioRxiv - Biophysics 2019
Quote:
... and the supernatant applied for 3 h at 4°C to 5 mL of Toyopearl AF-Chelate-650M resin (Tosoh) precharged with Ni2+-ions ...
-
No products found
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and laminaripentaose β-1-3-(Glc)5 at a concentration of 1.5 mg·mL−1 were used as standards (Megazyme, Bray, Ireland). To visualize the glucan fragments ...
-
No products found
because this supplier's products are not listed.
Lori Minassian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... cells were fixed with 100% cold methanol and imaged with a spinning disk confocal microscope (Quorum WaveFX; Quorum Technologies, Puslinch, ON) at 40x magnification ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
Alginate 5% is a viscous alginate hydrogel, suitable for both bioprinting and casting. You can...
Cat# IKA325000503,
5 mL, USD $220.0
Ask
Amber L. Altrieth, et al.,
bioRxiv - Cell Biology 2023
Quote:
Collagen hybridizing peptide (CHP) conjugated to 5-carboxyfluorescein (5-FAM) (Advanced BioMatrix) was solubilized per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Olamide Ishola, et al.,
bioRxiv - Biochemistry 2024
Quote:
... aliquots of the apoAI-EfpA in β-DDM and in lipid were placed in 1.5 ml tubes and then mixed with 5 nm Gold Nanoparticles (5-nm Gold-Ni-NTA, Nanoprobes) (GNPs ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Kevin Christian M. Gulay, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Endogenous peroxidases were quenched with 0.3% H2O2 in methanol for 15 min at RT before blocking the tissue sections with 10% normal rabbit serum (Nichirei biosciences, Tokyo, Japan) for an hour at RT and incubating with KDM2B antibody (sc-293279 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Amber Gonda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were lysed and incubated for 5 minutes in Trizol and then 1-bromo-3-chloropropane (BCP) (Molecular Research Center, Inc. Cincinnati, OH) was added to separate the RNA from the remaining material ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
LMP Heinilä, et al.,
bioRxiv - Microbiology 2020
Quote:
... Freeze-dried biomass was weighed and extracted with 0.5 ml methanol and glass beads (0.5-mm glass beads, Scientific Industries Inc, USA) using a FastPrep cell disrupter two times for 25 s at a speed of 6.5 m/s ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Jing Zhou, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 5 × 5-cm white compressed cotton pad (Nestlets, Ancare) was placed in the center of the cage ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5% defibrinated horse blood (Hemostat Labs), 10 mg/ml vancomycin (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Jing Wang, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 µM Ub (U-100H, Boston Biochem) and 5 µM UbcH7 (E2-640 ...
-
No products found
because this supplier's products are not listed.
Thomas M. Savage, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... CD4 APC (Tonbo Biosciences; clone RM4-5) and CD8 PE (Tonbo Biosciences ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Embryos are placed in pre-equilibrated (at least 4 h at 37°C, 5% O2, 5% CO2) CSCM-C medium (Irvine Scientific) covered with mineral oil (Irvine Scientific ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Djem U. Kissiov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... In all cases medium contained 5% FCS (Omega Scientific), 0.2 mg/mL glutamine (Sigma) ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...