-
No products found
because this supplier's products are not listed.
Lucas Caldi Gomes, et al.,
bioRxiv - Neuroscience 2024
Quote:
... using a ROX 1000 Size Ladder (Asuragen), followed by analysis with GeneMapper 4.0 software (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Yuan Xue, Ido Braslavsky, Stephen R. Quake,
bioRxiv - Biochemistry 2021
Quote:
... Reaction master mix and polymerase were separately equilibrated to −19°C on a TropiCoolerTM (Boekel Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Min-Ting Lee, Henry H. Le, Elizabeth L. Johnson,
bioRxiv - Microbiology 2020
Quote:
... Barcoded forward and nonbarcoded reverse primers were used with Taq DNA polymerase Master Mix (TONBO biosciences, CA) according to the manufacturer’s directions ...
-
No products found
because this supplier's products are not listed.
Leanne E. Wybenga-Groot, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 mM Na3VO4) at rt for 5-10 min before addition of master mix (42 pmol E1 (UBE1, Boston Biochem or Ubiquitin-Proteasome Biotechnologies) ...
-
No products found
because this supplier's products are not listed.
Ya Zhou, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples were run on an ABI3730XL Genetic Analyser with MapMarker ROX 1000 (Bioventures) internal size standards and analyzed using GeneMapper v5 software (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Solize Vosloo, et al.,
bioRxiv - Genomics 2021
Quote:
... stained with SYBR Green I (SG) (Invitrogen™, Cat. No.: S7585) (1:100 diluted in 10 mM Tris-HCl (pH 8.5, Bioworld, Cat. No: NC1213695)) at 10 μl.ml-1 or SG combined with propidium iodide (PI ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 2x gentamicin/amphotericin B (CELLnTEC, Bern, Switzerland) over night at 4 °C ...
-
No products found
because this supplier's products are not listed.
Chathura Wijesinghege, et al.,
bioRxiv - Plant Biology 2022
Quote:
... run on a Bio-Rad T100 Thermal Cycler (Hercules, CA, USA) with a PCR Master mix Solution i-MAX II (iNtRON Biotechnology, S Korea). PCR products were separated on a 1% agarose gel.
-
No products found
because this supplier's products are not listed.
Ulrich Dobramysl, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mNeon green was amplified from pNCS mNeon green (Allele Biotech) with primers GCTTCGAGCTCATCGATGGTGAGCAAGGGCGAGGAGGATA ACATGGCCTC and ATCAGGGATCACTTGTACAGCTCGTCCATGCCCATC.
-
No products found
because this supplier's products are not listed.
Anahit Galstyan, Jennifer L Nemhauser,
bioRxiv - Plant Biology 2019
Quote:
... Low Adhesive Dnase/RNase free tubes (Bioplastics, B74030) were used for all the procedures ...
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Physiology 2024
Quote:
... Prothrombin activity was determined chromogenically using a commercially available assay (Rox Prothrombin; DiaPharma, West Chester, OH), as previously described (59) ...
-
No products found
because this supplier's products are not listed.
Du-Hwa Lee, et al.,
bioRxiv - Plant Biology 2022
Quote:
... RealHelixTM qPCR kit (NANOHELIX; Korea), and the StepOnePlus Realtime PCR System (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Patrick M. Exconde, et al.,
bioRxiv - Immunology 2023
Quote:
... NP-40 Lysis Buffer Low Salt (Thomas Scientific, C994H79).
-
No products found
because this supplier's products are not listed.
Andrea Walens, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... tumor lysates were made in 2X lysis buffer (RayBiotech, Norcross, GA) and diluted to 50 μg per 100 μL in diluent provided ...
-
No products found
because this supplier's products are not listed.
Jingyi Wei, et al.,
bioRxiv - Bioengineering 2023
Quote:
... low passage cells were passaged with Accutase (Innovative Cell Technologies) and plated into Cultrex (R&D Systems 343400502)-coated 96-well plates with mTESR media containing ROCK inhibitor Y-27632 (10 uM ...
-
No products found
because this supplier's products are not listed.
Anna D. Kashkanova, et al.,
bioRxiv - Biophysics 2022
Quote:
... Ultra-low-density lipoproteins were purchased from Lee Biosolutions (194-14).
-
No products found
because this supplier's products are not listed.
Bart Coppens, et al.,
bioRxiv - Microbiology 2022
Quote:
... green fluorescent aminated (radius = 50 nm) or green fluorescent carboxylated (radius = 60 nm) polystyrene nanoparticles (Spherotech) were gently pipetted directly below the liquid-air interface to avoid structural disturbance of the biofilms ...
-
No products found
because this supplier's products are not listed.
Michael JV White, et al.,
bioRxiv - Immunology 2022
Quote:
Low stiffness tissue-culture plates were ordered from Matrigen (San Diego, CA). Culture of myofibroblasts on low stiffness surfaces was similar to the culture conditions on tissue-culture treated plasticware ...
-
No products found
because this supplier's products are not listed.
Abbigayl E.C. Burtis, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells were washed 2x with PBS containing 2% FBS (Atlas Biologicals, Fort Collins, CO). Viable T cells were enriched using the Easy Sep T cell isolation Kit followed by the Easy Sep Dead Cell removal Kit (Stem Cell Technologies ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... while injections of CTb 1% (low salt, 1%, List Biological Laboratories, Campbell, CA) in distilled water ...
-
No products found
because this supplier's products are not listed.
Charlotte Garot, et al.,
bioRxiv - Bioengineering 2022
Quote:
... two different concentrations were used: 30 µg/mL (low dose, BMP-2 LD) and 60 µg/mL (high dose ...
-
No products found
because this supplier's products are not listed.
Facundo Romani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... fitted with a low polarity Zebron ZB-5 (30 m × 250 μm i.d., Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Yamato Goto, Seigo Iwata, Eijiro Miyako,
bioRxiv - Bioengineering 2022
Quote:
... indocyanine green (ICG, 1 mg/mL; Tokyo Chemical Industry) was dissolved in PBS with 5% cremophor EL (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Mike R. Schlabach, et al.,
bioRxiv - Immunology 2023
Quote:
... Ribonucleoprotein (RNP) master mixes containing Cas9 protein (Aldevron, Cat#9212) and u728 sgRNA or a7mm OLF sgRNA were added to the cell suspension and transferred to processing assembly (MaxCyte) ...
-
No products found
because this supplier's products are not listed.
Julienne LaChance, Kevin Suh, Daniel J. Cohen,
bioRxiv - Systems Biology 2021
Quote:
MDCK-II cells were cultured in low glucose DMEM supplemented with 10% Fetal Bovine Serum (Atlanta Biological) and penicillin/streptomycin as done previously14 ...
-
No products found
because this supplier's products are not listed.
Lynn G. Schrag, et al.,
bioRxiv - Molecular Biology 2020
Quote:
P53-(1-73) variants were then transformed into BL21(DE3) low background strain (LOBSTR, Kerafast, Boston, Massachusetts) chemically competent cells and selected for with LB agar plates with 50 µg/mL Kanamycin and 1%(w/v ...
-
No products found
because this supplier's products are not listed.
Arianna Fozzato, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A rat insulin ELISA kit low range assay (0.1-6.4 ng/ml) (Crystal Chem, Elk Grove, IL, USA) was used to measure insulin plasma levels according to manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Isabelle Fabrizi, et al.,
bioRxiv - Paleontology 2023
Quote:
... Samples were vortexed at a low speed for 5 min (Vortex genie® 2, Scientific Industries, Inc., USA) and the solution was placed in a new 1.5 mL Eppendorf™ tubes ...
-
No products found
because this supplier's products are not listed.
Sevan N. Alwan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... each sample then was placed in 2 ml tubes of Lysin Matrix Tubes containing 1.4 mm ceramic spheres and then homogenized 2x using Beadbeater homogenizer (Biospec, USA) for 45 seconds ...
-
No products found
because this supplier's products are not listed.
Bente Rackow, et al.,
bioRxiv - Microbiology 2024
Quote:
... Whole genome sequencing using the Illumina NovaSeq platform with a read length of 2x 150 bp was performed by GENEWIZ Germany ...
-
No products found
because this supplier's products are not listed.
Carla Huerta-López, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the mix was loaded into polytetrafluoroethylene (PTFE) tubing (Cole-Parmer) (din = 0.022 inch ...
-
No products found
because this supplier's products are not listed.
Vijay K Samineni, et al.,
bioRxiv - Neuroscience 2021
Quote:
Anxiety was measured in low light conditions (~20 lux) using a modified zero maze (Stoelting Co., Wood Dale, IL) placed 70 cm off of the ground and consisting of two closed sections (wall height ...
-
No products found
because this supplier's products are not listed.
Melissa A. Roberts, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Lipid droplets were stained with 0.5 µM Lipi-Green (Dojindo Molecular Technologies) for 2 hours and nuclei were stained with 5 µg/mL Hoeschst 33342 for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Elinor Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... a 13 lipid class Lipidyzer Internal Standard Mix (AB Sciex, 5040156) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Keith R. Carney, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Embryos were dechorionated at 24 hpf and embedded in 1.6% low melting point agarose (in E2+gentamycin) in Delta T dishes (Bioptechs (#0420041500C)) ...
-
No products found
because this supplier's products are not listed.
Grant R. Kolar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The sections were then rinsed with 2X saline sodium citrate (SSC) for 5 min and an Adhesive SecureSeal Hybridization Chamber (Grace Bio-Labs) was placed over the tissue ...
-
No products found
because this supplier's products are not listed.
Daisuke Oikawa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 10:1 mix of the 4H8 WH2 (Adipogen, AG-20B-0008) and 3C8 (eBiosciences ...
-
No products found
because this supplier's products are not listed.
TP Prescott, K Zhu, M Zhao, RE Baker,
bioRxiv - Biophysics 2021
Quote:
... FNC Coating Mix was purchased from Athena Enzyme Systems (Baltimore, MD, USA). Dow Corning high-vacuum grease was purchased from ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Fan Bu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were stained with TUNEL reaction mix (E-CK-A325, Elabscience, China) for 1h at 37°C in dark and then stained by DAPI for 5min ...
-
No products found
because this supplier's products are not listed.
Katherine J. Turner, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rabbit anti-green fluorescent protein (GFP; Torrey Pines Biolabs, Cat# TP401, dilution 1:1000), rat anti-GFP (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
A.L. Gard, et al.,
bioRxiv - Microbiology 2020
Quote:
... The COP layers were adhered together using low-glass transition temperature COC in a heated hydraulic press (Carver Inc., Wabash, IN, USA), and were separated with a 24 µm-thick track-etched polycarbonate membrane with pore diameter of 0.4 or 1 µm (it4ip S.A. ...
-
No products found
because this supplier's products are not listed.
A Mahdavi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... were acquired using a low-noise differential amplifier (DPA-2FL, npi electronic, GmbH) and an intracellular recording amplifier (NeuroData IR-283; Cygnus Technology Inc.), respectively ...
-
No products found
because this supplier's products are not listed.
Julia Bär, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A mix of 20 μM of porcine brain tubulin protein (Cytoskeleton/Tebu-Bio) with 1 mM GMPCPP (Jena Bioscience ...
-
No products found
because this supplier's products are not listed.
Blanca V. Rodriguez, et al.,
bioRxiv - Immunology 2023
Quote:
... with the “Mix” mode selected at a speed of 8 rpm (Benchmark Scientific Roto-Therm Plus Incubated Rotator ...
-
No products found
because this supplier's products are not listed.
Hala Tamim El Jarkass, et al.,
bioRxiv - Microbiology 2021
Quote:
1,000 synchronized L1 animals were mixed with 0.2 μm green fluorescent polystyrene beads (Degradex Phosphorex) at a ratio of 25:1 in a final volume of 400 μl containing 10 μl of 10x E ...
-
No products found
because this supplier's products are not listed.
Ming Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we tested 5hmC level by qPCR with BisulPlus™ Loci 5mC & 5hmC Detection PCR Kit (EpiGentek, #P-1067). Briefly ...
-
No products found
because this supplier's products are not listed.
Jamie S. Depelteau, et al.,
bioRxiv - Microbiology 2021
Quote:
... and subsequently mounted laterally in a drop of 1.3% low melting agarose on a Willco-dish glass bottom microscopy dish (Willco Wells B.V., Amsterdam, The Netherlands). Once the agarose solidified ...
-
No products found
because this supplier's products are not listed.
Shravanthi Rajasekar, et al.,
bioRxiv - Bioengineering 2021
Quote:
Green Fluorescent Protein-tagged Human Umbilical Vein Endothelial Cells (GFP-HUVECs, Angio-Proteomie, Cat# CAP-0001GFP) were grown in Endothelial Cell Growth Media (ECGM2 ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).