-
No products found
because this supplier's products are not listed.
Saptarshi Mallick, et al.,
bioRxiv - Physiology 2022
Quote:
... 2X TaqMan Universal Master Mix (Applied Biosystems, TaqMan® Gene Expression Systems), and cDNA template ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Reverse transcription quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR MasterMix (Alfagene) according to the manufacturer’s instructions and using primers forward and reverse at 0,25 μM (final concentration ...
-
No products found
because this supplier's products are not listed.
J. Martinez-Fabregas, et al.,
bioRxiv - Immunology 2020
Quote:
... Agencourt AMPure XP beads and PCR amplified using KAPA hot start High-Fidelity 2X PCR Master Mix and NextFlex index primers (Bioo Scientific, PerkinElmer) for 12 cycle by following thermocycler cycles ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... PCRs used GoGreen Taq Plus Master Mix (Lamda Biotech) with general cycling conditions of 95 C for 2 min ...
-
No products found
because this supplier's products are not listed.
Seth Winfree, et al.,
bioRxiv - Physiology 2022
Quote:
... antibodies were reduced using a “Reduction Master Mix” (Akoya Biosciences) to which lyophilized barcodes resuspended in molecular biology grade water and “Conjugation Solution” (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
William K. Boyle, et al.,
bioRxiv - Microbiology 2020
Quote:
... using Bullseye EvaGreen Master Mix (MIDSCI, St. Louis, MO, United States) reagents and oligonucleotide primers targeting the gene of interest (Supplemental Table 1) ...
-
No products found
because this supplier's products are not listed.
Sarah Bahraoui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Quantitative PCR was performed on 6,25ng of cDNA using the SensiFAST™ SYBR® No-ROX kit (Bioline, Meridian Life Science© Company) and a LightCycler® 480 Detection system (Roche) ...
-
No products found
because this supplier's products are not listed.
Youssouf Sereme, et al.,
bioRxiv - Microbiology 2020
Quote:
... the poliovirus antigen (0.24 μg/μL) was mixed with fluorescent 5X master mix (Protein Simple) to achieve a final concentration of 0.20 μg/μL in the presence of fluorescent molecular weight markers and 400 mM dithiothreitol (DTT ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Sofia Bali, et al.,
bioRxiv - Biophysics 2023
Quote:
... A 2X heparin concentration (Amsbio) was added to the tauRD protein ...
-
No products found
because this supplier's products are not listed.
Masato Sadahiro, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A low-impedance tungsten electrode (FHC) was inserted into the V1 binocular zone near 3.00mm from lambda ...
-
No products found
because this supplier's products are not listed.
Matthew D. Slein, et al.,
bioRxiv - Immunology 2023
Quote:
... Low-tox Guinea Pig complement (Cedarlane) was reconstituted in 1 mL cold distilled water ...
-
No products found
because this supplier's products are not listed.
Yutian Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... oxidized low-density lipoprotein (ox-LDL, BioVision, USA) was added to the culture medium to mimic diabetic conditions ...
-
No products found
because this supplier's products are not listed.
Jorge Ibañez-Vega, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ~2x 107 3-μm latex NH2-beads (Polyscience, Eppelheim, Germany) were activated with 8% glutaraldehyde for four h at room temperature ...
-
No products found
because this supplier's products are not listed.
Yong Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and homogenized at a relatively low speed (T10, IKA). The resulting suspension was centrifuged at 600 x g for 2.5 min at 4°C and washed three times in relaxing solution ...
-
No products found
because this supplier's products are not listed.
Randy Yoo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 96-well plate low volume crystallization plates (Hampton Research) were all set up at room temperature using sitting drop method with ratios 1:1 and 1:2 for precipitant to protein ...
-
No products found
because this supplier's products are not listed.
Carolina Flores-Muñoz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... low-pass filtered (1700 Differential AC Amplifier, A-M Systems), and then digitized (NI PCI-6221 ...
-
No products found
because this supplier's products are not listed.
Junyu Chen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Low binding silica beads (400 μm, Ops Diagnostics, Lebanon NJ) were added to each sample and vortexed at high speed ...
-
No products found
because this supplier's products are not listed.
Alejandro Méndez-Mancilla, et al.,
bioRxiv - Bioengineering 2021
Quote:
... washed 2X in Dulbecco’s PBS without calcium or magnesium (D-PBS, Caisson Labs) and resuspended in 20 μl P3 Primary Cell Nucleofector Solution (Lonza V4XP-3032) ...
-
No products found
because this supplier's products are not listed.
Jonathan H Massey, et al.,
bioRxiv - Genetics 2019
Quote:
... transferred into a clean vial (Wheaton 0.25 mL with low volume insert), and stored at −20°C.
-
No products found
because this supplier's products are not listed.
Lakshmi E. Miller-Vedam, et al.,
bioRxiv - Biophysics 2020
Quote:
... Then washed with low salt buffer with b-DDM+CHS (Anatrace, CH210) (10:1 ...
-
No products found
because this supplier's products are not listed.
Gebeyaw G. Mekonnen, et al.,
bioRxiv - Microbiology 2020
Quote:
... The low endotoxin contamination was confirmed by Endosafe® cartridge (Charles River). The purified recombinant proteins were aliquoted and stored at −80°C.
-
No products found
because this supplier's products are not listed.
Liliana M. Sanmarco, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were washed 2X with 0.05% Tween in 1X PBS (Boston BioProducts, #IBB-171X) and blocked with 1% BSA in 1X PBS (Thermo Fisher Scientific ...
-
Phosphate Assay Kit (POMG-25H)
Cat# POMG-25H,
1.0 kit, 2500 tests, USD $219.0
Ask
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
Malachite Green Phosphate Assay Kit (BioAssay Systems);
-
No products found
because this supplier's products are not listed.
Gilles Vanwalleghem, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The larvae were immobilized in 2% low melting point agarose (Progen Biosciences, Australia) and imaged using a diffuse digitally scanned light-sheet microscope (Taylor ...
-
No products found
because this supplier's products are not listed.
Kyriaki Barmpa, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and they were transferred in 24 well ultra-low attachment plates (Celltreat, 229524). Some of the assembloids were embedded in 30 µl Geltrex (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Balázs Knakker, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... low-palatability banana flavoured pellets (denoted ‘b’, Dustless Precision Pellets®, Bio-Serv, Inc. ...
-
No products found
because this supplier's products are not listed.
Sehwan C Park, et al.,
bioRxiv - Genomics 2019
Quote:
... supplemented with Torpedo antibiotic mix (BioIVT) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Juan Jesus Vicente, et al.,
bioRxiv - Cell Biology 2024
Quote:
... then washed 2x with same buffer except NP-40 replaced by 1% PPS detergent (Expedeon). Immunoprecipitated complexes were released from beads with 0.2 M acetic acid and dried.
-
No products found
because this supplier's products are not listed.
Zhang-He Goh, Jie Kai Tee, Han Kiat Ho,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 20 µL of this suspension was mixed with low-melting agarose (Trevigen, United States), spread evenly over CometSlides (Trevigen ...
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Viola Nähse, et al.,
bioRxiv - Cell Biology 2022
Quote:
ATPase activity was measured by quantifying the release of inorganic phosphate using a modified Malachite Green Phosphate assay (Biomol Green, Enzo). All measurements were performed according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ozan Çiftçi, et al.,
bioRxiv - Genomics 2022
Quote:
... Four strains (DCG0091, DCG0092, DCG0094, DCG0751) were observed on a JSM-6480 Low Vacuum (JEOL) SEM platform at 10 kV ...
-
No products found
because this supplier's products are not listed.
Sathish Ramakrishnan, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Calcium Green conjugated to a lipophilic 24-carbon alkyl chain (Calcium Green C24) was custom synthesized by Marker Gene Technologies (Eugene, OR)
-
No products found
because this supplier's products are not listed.
Manali M. Kamath, et al.,
bioRxiv - Microbiology 2023
Quote:
... Green bead lysis kits (Next Advance, New York, USA) that contain stainless steel beads in combination with TissueLyser LT (Qiagen ...
-
No products found
because this supplier's products are not listed.
Manthan Patel, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The dot blots were then incubated with 50 μl of rabbit polyclonal anti-CGGBP1 antibody mix (a mix of 1:120 dilutions of SC-292517, SCBT and 10716-1-AP, Proteintech) overnight with gentle rocking ...
-
No products found
because this supplier's products are not listed.
Matthew Neubauer, Roger W. Innes,
bioRxiv - Plant Biology 2020
Quote:
... seed was directly sowed onto Pro-Mix PGX Biofungicide plug and germination mix supplemented with Osmocote 14-14-14 fertilizer (ICL Fertilizers). Plates and flats were placed at 4°C for 48 hours for stratification before being transferred to a growth room set to 23°C and 12 hour light (150 µEm-2s-1)/12 hour dark cycle ...
-
No products found
because this supplier's products are not listed.
Kevin M. Boardman, et al.,
bioRxiv - Genetics 2022
Quote:
Low Biotin Synthetic Complete (LBSC) Media contained 1.56 g/L BSM Powder (Sunrise Science Products Cat#1387), 1.71 g/L YNB – Biotin powder (Sunrise Science Products Cat#1523) ...
-
No products found
because this supplier's products are not listed.
Raquel P. de Sousa Abreu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... chicken α-Green Fluorescence Protein (GFP) (Aves Labs, Inc., GFP-1010), and goat α-Choline Acetyltransferase (ChAT ...
-
No products found
because this supplier's products are not listed.
Raluca Groza, et al.,
bioRxiv - Biophysics 2023
Quote:
... Purified recombinant Enhanced Green Fluorescent Protein (EGFP) was purchased from Chromotek. Bafilomycin A1 was purchased from InvivoGen ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... A mix of 125 ng/μl Cas9 mRNA (System Biosciences), 12.5 μM gRNA (IDT) ...
-
The 5-FAM (Green) Collagen Hybridizing Peptide (CHP) is a synthetic peptide that can...
Cat# 5264-60UG,
0.3 mg, USD $290.0
Ask
M. E. Torki, Z. Chen, F. Liu,
bioRxiv - Cell Biology 2023
Quote:
... and embedded in low-density (1.66 mg/mL) and mid-density (3 mg/mL) bovine collagens (PureCol, Advanced Biomatrix) [65] ...
-
No products found
because this supplier's products are not listed.
Adrian Izquierdo-Martinez, et al.,
bioRxiv - Microbiology 2022
Quote:
... the mix was passed through C-18 microspin columns (Harvard Apparatus), previously conditioned with acetonitrile and equilibrated with buffer A (0.1% [v/v] TFA in water) ...
-
No products found
because this supplier's products are not listed.
Artyom Luzhin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and then stained with Vista Green (Cell Biolabs, San Diego, CA, cat # 235005) diluted 1:10,000 in TE buffer ...
-
No products found
because this supplier's products are not listed.
Madhukar Vedantham, et al.,
bioRxiv - Immunology 2024
Quote:
... Unspecific binding to low-affinity Fc-receptors was blocked by incubating the cells with unconjugated CD16/32 antibody (BioXCell, clone 2.4G2). Cells were subsequently stained for 30 min at 4 °C with antibodies diluted in the FACS buffer ...
-
No products found
because this supplier's products are not listed.
Farhana Islam, Padmaja P. Mishra,
bioRxiv - Biophysics 2023
Quote:
... The experiments were conducted using a Monolith NT.115 Blue/Green instrument (NanoTemper Technologies) in three independent replicates ...
-
No products found
because this supplier's products are not listed.
Patrick N. Reardon, et al.,
bioRxiv - Biophysics 2023
Quote:
... RNA bands were stained with Midori Green Nucleic Acid staining solution (Bulldog Bio. Inc. Portsmouth, NH) and visualized using a Bio-Rad Gel Doc Image system.
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Andrew J. Radosevich, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... flow system consists of a 25 mL syringe pump SP1 that provides model blood flow and two 100 μL syringe pumps SP2 and SP3 whose flow streams are combined in a low-volume mixing T (IDEX U-466S, 2.2 μL swept volume) to introduce compound at a user specified concentration into the model blood vessel ...
-
No products found
because this supplier's products are not listed.
Carlos Manlio Díaz-García, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the viral mix was loaded onto a pulled glass capillary pipette (Wiretrol II, Drummond Scientific Company, Broomall, PA) and the pups were intracranially injected with 150 nl of the AAV mix ...