Labshake search
Citations for Allele Biotechnology and Pharmaceuticals :
1 - 2 of 2 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mNeon green was amplified from pNCS mNeon green (Allele Biotech) with primers GCTTCGAGCTCATCGATGGTGAGCAAGGGCGAGGAGGATA ACATGGCCTC and ATCAGGGATCACTTGTACAGCTCGTCCATGCCCATC.
-
bioRxiv - Cell Biology 2020Quote: ... mNEON-green-β-actin was purchased from Allele Biotechnology. pHalo-C1-NM2C (Halo-NM2C ...