-
No products found
because this supplier's products are not listed.
Joseph Mills, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 3-(2-Methyl-5-nitro-imidazol-1-yl)-N-(2,2,2-trichloro-1-phenylamino-ethyl)-propionamide) (Sigma-Aldrich SML1503). Drugs were diluted in culture media at treatment.
-
No products found
because this supplier's products are not listed.
Fabian M. Meyer, et al.,
bioRxiv - Microbiology 2023
Quote:
... cells were resuspended in 25 µl PBS together with 0.25 µl of 5 mM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl) carbonyl]amino]-D-alanine hydrocholoride (HADA) (Tocris) dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Aniqa Tasnim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recovery aCSF included (R,S)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid (CPP, 5 μM; Abcam, ab120160) and 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Shaw, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Lisa Weixler, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-tubulin 1:5000 (B-5-1-2 Santa Cruz). For slot blotting ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
anti-Dynamin 1/2/3-mouse (BD Science, 1:1000), anti-Pacsin2-Rabbit (Proteintech ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Esther Nuebel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... in a ratio of 3:2:1 using 1 mg/ml polyethylenimine (Cat#23966-1, Polysciences, Inc.). Retrovirus was harvested from the medium 48 h post-transfection ...
-
No products found
because this supplier's products are not listed.
John P. Gillies, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1-1/2 coverslips (Corning) sonicated in 100% ethanol for 10 min were used for the flow-chamber assembly ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Gantsetseg Tumurkhuu, et al.,
bioRxiv - Immunology 2024
Quote:
2’-3-cyclic GMP-AMP (cGAMP) (tlrl-nacga23-1, InvivoGen) was added at 10μg/mL with or without 4μM H151 (inh-h151 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Bart Theeuwes, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... EBs were split 1:2 in SF-D media containing rhVEGF (5 ng ml-1; R&D Systems), rhBMP4 (10 ng ml-1 ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Ruilian Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... After that, Samples were infiltrated in graded mixtures (1:3, 1:1, 3:1) of resin (EMS, Resin Mixture ...
-
No products found
because this supplier's products are not listed.
Catherine F. Ruff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were washed in 0.1M cacodylate buffer and postfixed with 1% osmium and 1.5% potassium ferrocyanide in cacodylate buffer for 1 hr at RT after sections were dehydrated in an ascending gradient of ethanol (ETOH ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Trevor A. Zandi, et al.,
bioRxiv - Biophysics 2024
Quote:
... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
No products found
because this supplier's products are not listed.
Clayton E. Friedman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5 ng/mL FGF-2 (RnD Systems) and 1 µM CHIR99021 (Stem Cell Technologies) with daily medium exchange for 3 days ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
The original balance of enzymatic activities. Each lot assayed for collagenase, caseinase,...
Cat# LS004194,
100 mg, $42.00
Ask
Oscar A. Davalos, et al.,
bioRxiv - Immunology 2024
Quote:
... and 3 mg/mL collagenase 1 (Worthington)) and minced with scissors into pieces approximately 1 mm in diameter ...
-
No products found
because this supplier's products are not listed.
Lakmini S. Premadasa, et al.,
bioRxiv - Pathology 2024
Quote:
... Adapter-ligated fragments of 150-250bp and 250-300bp were recovered from a 2/5% NuSieve 1:1 agarose gel (Zymoclean Gel DNA Recovery Kit, Zymo Research). The fragments were then bisulfite treated using EX DNA Methylation-Lightning Kit (Zymo Research) ...
-
No products found
because this supplier's products are not listed.
Minji Ai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 1-hour each), xylene (3×, 1.5-hour each), paraffin (3 ×, 2-hours each) (Fisher, UK) in tissue processor (Leica TP1020 tissue processor, UK) and embedded in paraffin using embedding station (Leica HistoCore Arcadia H embedding station ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Thillai V. Sekar, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1/3 for CD8+ selection (Miltenyi Biotec) and 2/3 for CD4+ subsets (both positive selection for CD4+CD25+cells and negative selection for CD4+CD25- cells Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Jian Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... PBMCs (1×106) were stimulated with SARS-CoV-2 spike protein (S1+S2_ECD, 5 μg/ml, Sino Biological, Beijing, China) or BSA (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Breygina Maria, et al.,
bioRxiv - Plant Biology 2020
Quote:
MP of pollen protoplasts was assessed by staining with 1 µM DiBAC4(3) for 5 min (Breygina et al. 2010) on Gallios flow cytometer (Beckman Coulter), analysis was performed with FlowJo software (TreeStar) ...