Labshake search
Citations for Agilent :
1 - 50 of 4538 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Neuroscience 2024Quote: ... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFAP rabbit (Agilent Cat# 033401-2; 1:1000 ICC, 1:1000 IHC), anti-GFAP chicken (Encorbio Cat# CPCA-GFAP ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Pyruvate and 2 mM Glutamine (Agilent; 103015-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-GFAP (1:5,000, Dako, Z033401-2). The next day ...
-
bioRxiv - Immunology 2021Quote: ... stained with hematoxylin (Agilent, S330930-2, 1 mL), and incubated at room temperature for 7 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-CD31 (1:200 dilution, M082329-2, Dako), Goat anti-Rabbit IgG Cross-Adsorbed Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Gfap (1:1000, Agilent #Z033401-2); rabbit anti-alpha-Sma (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Genomics 2024Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4×2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD68 (clone KP1; 1:100; M087629-2, DAKO), and Ki67 (clone SP6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD4 (clone 4B12; 1:50; M731001-2, DAKO), FOXP3 (clone D2W8E ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100β (1:1000, Agilent, GA50461-2), chicken anti-NF200 (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... blocked for 1 hr in 2% BSA + 0.1% Tween20 + 1:50 normal goat serum (DAKO) in PBS and washed twice with PBS + 0.5% Tween ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-rabbit IgG (250 ng ml−1, 1% BSA in PBST; Agilent, P044801-2) or rabbit anti-goat IgG (500 ng ml−1 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse anti-Ki67 (1:400, M724029-2, Agilent, UK) was used to label proliferative cells and rabbit anti-cleaved-Caspase3 (1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki-67 (M7240) (M724029-2, Agilent, 1:400 dilution), γH2AX (phospho-S139 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse clone CR3/43 (1:20, Agilent, M077501–2). Sections were incubated for 1 hour at room temperature with secondary antibodies (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...