Labshake search
Citations for Eppendorf :
1 - 50 of 988 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The 1 ml of PBS with the resuspended cells was transferred to a 1·5 ml Protein LoBind tube (Eppendorf), centrifuged at 3000 x g for 6 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated for 1 h before centrifugation (Eppendorf centrifuge R5810, 4000 rpm for 5 min), followed by quantification of β-galactosidase activity.
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were collected in pre-chilled 1% BSA-blocked 5 mL Protein LoBind tube (Eppendorf) containing the 2% BSA-PBS wash buffer detailed above and kept on ice.
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmid DNA (1-5 μg/μl) was microinjected into the fourth ventricle of the embryos (FemtoJet; Eppendorf). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 15 mL polypropylene tubes were replaced with 1% BSA-blocked 5 mL Protein LoBind tubes (Eppendorf). Briefly ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Microbiology 2023Quote: ... we centrifuged 1 mL overnight-cell culture in a 1.5 mL Eppendorf tube at 7’500 rcf for 5 min (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pH 7.6) and injected into 1 to 2-cell-stage embryos by using a microinjector FemtoJet 5247 (Eppendorf). The sequences and the concentrations of MOs (Gene Tools ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-2 fecal pellets were collected from each mouse by voluntary defecation into a sterile microtube (Eppendorf, Germany) and fecal samples were immediately placed on dry ice ...
-
bioRxiv - Microbiology 2024Quote: ... The collected sample was concentrated in a SpeedVac (45°C, V-AQ, 1-2 hrs) (Eppendorf Concentrator 5301). The samples were stored at 20°C until LC-MS measurement.
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The fractions with highest concentrations (200–400 μg mL−1) were stored as 5–10 μL aliquots in Protein LoBind tubes (Eppendorf) at –80 °C.
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Neuroscience 2023Quote: Neurons remained in medium and were incubated in ∼1% O2 (5% CO2, 37°C) for 360 min in a triple-gas incubator (Eppendorf) and then returned to normoxic conditions (21% O2 ...
-
bioRxiv - Genomics 2024Quote: ... and incubated on ice for 1 minute before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). The supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Cancer Biology 2024Quote: ... EVs-beads conjugates were then incubated with 15 uL EVs detection reagent (5 uL of CD9, CD63, CD81 detection reagents) for 1 hour at room temperature in Thermomixer orbital shaker (Eppendorf). Samples were washed with 500 uL MACSPlex buffer and centrifuged at 3000xg for 5 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Bioengineering 2021Quote: ... CsupADH_17286 and HzeaADH7 were introduced into Agrobacterium tumefaciens GV3101 strain (MP90RK) by electroporation (1700 V mm-1, 5 ms, Eppendorf 2510). A viral silencing suppressor protein P19 was introduced into GV3101 strain as well in order to inhibit the host cells’ transgene silencing apparatus and extend transgene expression over a longer period of time with a higher degree of expression (Canto et al ...
-
bioRxiv - Cell Biology 2023Quote: ... or at 37°C/5% CO2/1% O2 in a nitrogen-controlled hypoxic incubator (New Brunswick Galaxy 170R, Eppendorf, Hamburg, Germany). Prior to media changes ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... the mucin beads sampled from different time points were first washed with 1 ml filter-sterilized PBS in 2-ml tubes (Eppendorf). After carefully removing the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Microbiology 2023Quote: Overnight cultures of the investigated strains were prepared in 1 mL aliquots of TSB in 2 mL microcentrifuge tubes (Eppendorf) which were incubated horizontally with shaking (120 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were re-suspended in 0.1% formic acid (FA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...