-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Hannah J. Larsen, et al.,
bioRxiv - Physiology 2022
Quote:
... Arachidonic Acid (P/N 390) and ADP (P/N 384) were purchased from Chrono-Log Corporation ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Samuel Lim, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... turbonuclease (Accelagen) and 1% n-Nonyl-Beta-D-Glucopyranoside (Cube Biotech) and shaken vigorously for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
Cat# AB-314,
100 micrograms,USD $565.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... anti-p75 conjugated saporin (p75-saporin) or IgG-saporin control (n = 8 / group, Advanced Targeting Systems) was diluted to final concentration of 0.4 mg/ml in normal saline ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Neha Ahuja, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Genotypes were determined by polymerase chain reaction (PCR) after O/N digestion using DirectPCR (Tail) Lysis buffer (Viagen, Los Angeles, CA) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
Recombinant AAV-2 VP1 Protein was expressed in E. coli.
Cat# VP1-1787A,
10ug , USD $298
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Alan Shaw, et al.,
bioRxiv - Biophysics 2023
Quote:
... Ligand for Broccoli RNA aptamer BI (LuceRNA) was prepared in 50mM DMSO and further diluted in water ...
-
No products found
because this supplier's products are not listed.
Manja Czech-Sioli, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... ChIP and corresponding input libraries were prepared from 2–10 ng DNA using the NEXTflex Illumina ChIP-Seq Library Prep Kit (#5143–02; Bioo Scientific, Austin, TX, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ons M’Saad, Joerg Bewersdorf,
bioRxiv - Cell Biology 2020
Quote:
... and then resuspended in Opti-MEM with 10 μg DNA in an electroporation cuvette with a 2-mm gap (Bulldog Bio, catalog no. 12358346). Cells were electroporated with a poring pulse of 125 V ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Nicole M. Gaudelli, et al.,
bioRxiv - Genomics 2020
Quote:
... and 250IU/mL of recombinant human interleukin-2 (rhIL-2, CellGenix GmbH). Cells were activated with soluble human anti-CD3 (clone OKT3 ...
-
No products found
because this supplier's products are not listed.
Daniela Londono Vasquez, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with pregnant mare serum gonadotropin (Lee BioSolutions #493-10-10) according to 46,47 ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 mg/mL fibrinogen (Enzyme Research Laboratories), 0.1 mg/mL Alexa-Fluor 488 labeled fibrinogen for visualization (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Yun Liu, Weichun Lin,
bioRxiv - Neuroscience 2022
Quote:
... μ-conotoxin GIIIB (2 μM; Peptides International) was added to the bath solution 30 minutes prior to recording ...
-
No products found
because this supplier's products are not listed.
Prabhu S. Arunachalam, et al.,
bioRxiv - Immunology 2021
Quote:
... Alum (Alhydrogel 2%) was purchased from Croda Healthcare (Batch #0001610348) ...
-
No products found
because this supplier's products are not listed.
Ryan J. Garrigues, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2% C1q-depleted serum (LP; Complement Technologies), or 20% NHS (AP ...
-
No products found
because this supplier's products are not listed.
Kelsey S. Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... supplemented with 10% FBS (Equitech-Bio) and 1% penicillin/streptomycin (Lonza) ...
-
No products found
because this supplier's products are not listed.
Noe Kaneko, et al.,
bioRxiv - Neuroscience 2022
Quote:
... ChondroitinaseABC (10 U/ml) (Seikagaku Corporation), was first diluted 10-fold and then 1/2000 of it was added to the medium to a final concentration of 0.5 mU/ml in the culture medium (Neurobasal supplemented with B-27).
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Ekaterina Buzun, et al.,
bioRxiv - Microbiology 2023
Quote:
... for 16 h at 37 °C under anaerobic conditions (10 % H2, 10 % CO2, 80 % N2; Coy Lab Products). For growths utilizing a sole carbon source ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
B. H. Abuaita, et al.,
bioRxiv - Immunology 2019
Quote:
... CASPASE-2 FAM-VDVAD-FMK FLICA substrate (ImmunoChemistry Technologies) for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Xiaonan Xu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 10 µM drug using Echo650 (Labcyte/Beckman Coulter). The same volume of DMSO was used as negative control ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Leanne E. Wybenga-Groot, C. Jane McGlade,
bioRxiv - Biochemistry 2020
Quote:
... 10% (w/v) PEG8000 at rt using a Mosquito robot (TTP Labtech). Small rod-like crystals were observed after approximately five months ...
-
No products found
because this supplier's products are not listed.
Joseph R. Francica, et al.,
bioRxiv - Immunology 2021
Quote:
... The remaining PBS was mixed with 2 mL of RNAzol BD (Molecular Research Center) and 20 μL acetic acid ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 2×104 Target cells were seeded into 96 well E-Plate (ACEA Biosciences Inc.) and rested overnight ...
-
No products found
because this supplier's products are not listed.
Ahmed A. Shibl, et al.,
bioRxiv - Microbiology 2020
Quote:
... for 10 minutes followed by the EZNA Bacterial DNA kit (Omega Bio-Tek) according to the manufacturer’s instructions and then quantified on the Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Tianzi Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 μg/mL ECGS (Cell Biologics), 50 ug/mL heparin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jian He, et al.,
bioRxiv - Immunology 2022
Quote:
... with 10 μl/g liposome-clodronate (Liposoma) once a day for two days prior to experiment.
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Zarina Brune, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... fixed in 10% neutral buffered formalin (Anatech Ltd.) for 24 hours ...
-
No products found
because this supplier's products are not listed.
Marco Jost, et al.,
bioRxiv - Immunology 2020
Quote:
... with 10% defibrinated horse blood (Hemostat Laboratories, Dixon, CA). Liquid medium used for bacterial growth was supplemented BHI broth ...