-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Anouschka S. Ramsteijn, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cages were enriched with wooden stick for gnawing (10×2×2cm) and nesting material (Enviro-dri™, Shepherd Specialty Papers, Richland, MI, USA), and were cleaned weekly ...
-
No products found
because this supplier's products are not listed.
Oihana Iriondo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... KDM5-C70 (Xcess Biosciences, M60192-2), NSC636819 (Sigma ...
-
No products found
because this supplier's products are not listed.
Asuka Hirooka, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... a 10-amino acid-peptide called NMC or GRP-10 (AssayPro, St. Charles, MO, USA) for 48 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Yeranuhi Hovhannisyan, et al.,
bioRxiv - Pathology 2023
Quote:
... and CW30318 (Control 2, Fuji Cellular Dynamics) derived from healthy individuals without any cardiac pathology ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human α-thrombin (10 nM; Haematologic Technologies) or tumor necrosis factor alpha (TNFα ...
-
No products found
because this supplier's products are not listed.
Taylor B. Dolberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... or equivalent vehicle (10% DMSO (Protide Pharmaceuticals), 40% PEG-300 (Spectrum Chemical ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Jianmei ZHANG, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplement with 10% FBS (Crystalgen, New York, USA), 1×107 cells/well were seeded in 6 well plates and incubated at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Elisa S. Grassi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary Human Astrocytes (3H Biomedical Cat# 1800-10) were cultured in Human Astrocyte Medium #SC1801 (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Camila Ribeiro, et al.,
bioRxiv - Plant Biology 2020
Quote:
... plants were painted with a 2% glufosinate-ammonium (Bio-world), and non-transgenic segregants were removed (56) ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Pallavi Raj Sharma, et al.,
bioRxiv - Bioengineering 2021
Quote:
PLGA (Mw 10-15 kDa 50:50, Akina AP041) was used to synthesize microparticles using oil in water single emulsion method ...
-
No products found
because this supplier's products are not listed.
Michal Nemergut, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were vortexed (10 s, 2000 rpm, VELP Scientifica), homogenized (4 m/s ...
-
No products found
because this supplier's products are not listed.
Lei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... medium with 10 µL GeneTran III reagent (GT2211, Biomiga) in 6 cm2 cell culture dishes.
-
No products found
because this supplier's products are not listed.
Nathan M. Belliveau, et al.,
bioRxiv - Cell Biology 2022
Quote:
... resuspended in 10 mL PolymorphPrep (Cosmo Bio USA #AXS1114683) and added to the bottom of a 50 mL conical tube ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Lysates were reduced with 10 mM DTT (Indofine Chemicals) at 30°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Xavier Martiáñez-Vendrell, et al.,
bioRxiv - Microbiology 2024
Quote:
... mouse polyclonal against V5 tag at 1:2500 (A85280-10, Antibodies.com), rabbit polyclonal against FLAG tag at 1:500 (F7425 ...
-
No products found
because this supplier's products are not listed.
Rupashree Dass, et al.,
bioRxiv - Biophysics 2021
Quote:
... 10 mg 13C/15N-labelled α-synuclein (Giotto Biotech, Sesto Fiorentino, Italy) was dissolved in 550 μl 25 mM Tris buffer pH 9 ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and SARS-CoV-2 Spike protein S1 (Icosagen OÜ, Estonia, cat# P-305-100) were used in this study.
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Marion Le Gall, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... supplemented with 10% fetal calf serum and 1% ZellShield™ (Minerva Biolabs, Germany), at 37°C in a 5% CO2 incubator.
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...
-
No products found
because this supplier's products are not listed.
Silia Ayadi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 10 uL epicoprostanol (100 µg/ml dissolved in cyclohexane; Medical Isotopes Pelham, U.S.A.) as internal standard was added ...
-
No products found
because this supplier's products are not listed.
Lucas T. Laudermilk, et al.,
bioRxiv - Genetics 2020
Quote:
... Zfp30+/+ and Zfp30-/- mice were sensitized with 10 μg Der p 1 (Indoor Biotechnologies, Charlottesville, VA) administered through intraperitoneal injection (in 100 μl of PBS ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Jonathan Hus, et al.,
bioRxiv - Microbiology 2023
Quote:
... KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB) medium (Aldon Corporation Rochester, NY). These were grown overnight to saturation in a 37°C incubator and shaken vigorously at 250 cycles per minute on a rotary shaker ...
-
No products found
because this supplier's products are not listed.
Nelli Vahvelainen, et al.,
bioRxiv - Microbiology 2023
Quote:
... the medium was replaced with fresh RPMI supplemented with either 10 ng/ml IL-1β (ReliaTech, Wolfenbüttel, Germany) or an equivalent volume (5 µl ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Andrew S. Bray, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the suspension serially diluted and plated onto LB agar plates (Fisher, BP9745-2) In between sampling the plates were sealed with parafilm (Bemis, PM-999) and placed in the dark at room temperature.
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Rafaella Sales de Freitas, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the participants’ passive saliva was collected 10 min after a light mouthwash as described by the essay kit (Salimetrics, State College, PA). Specific instructions required participants to think of their favorite foods ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Takanori Eguchi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Cells were blocked in IHC/ICC blocking buffer high protein (eBioscience, San Diego, CA) for 10 min and then reacted with anti-MZF1 antibody (1:50, C10502; Assay Biotechnology, Fremont, CA) and AlexaFluor488 secondary antibody (Thermo Fisher Scientific ...