Labshake search
Citations for Tib Molbiol :
1 - 5 of 5 citations for 10 Undecenamide N N bis 2 hydroxyethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
bioRxiv - Immunology 2024Quote: ... 10 nM CpG 2216: GGGGGACGATCGTCGGGGGG or CpG 1668: TCCATGACGTTCCTGATGCT (Tib Molbiol) complexed to 30µg dotap (Roche/Merk ...
-
bioRxiv - Microbiology 2020Quote: ... and quantified with the LightMix Assay SARS-CoV-2 RdRP RTqPCR assay kit (TIB MOLBIOL, Germany) and the RNA Process Control kit (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Viral stock was confirmed by RT-qPCR (LightMix® SARS-CoV-2 RdRp-gene EAV PSR & Ctrl (TIB MOLBIOL). Reactions were run in a LightCycler® 480 real time-PCR system (Roche) ...