Labshake search
Citations for GenScript :
701 - 750 of 815 citations for Transglutaminase 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal antibody used to purify γ-TuRC from Xenopus egg extract was generated against a purified γ-tubulin peptide (amino acids 412-451) through a commercial vendor (Genscript). The presence of γ-TuRC during its purification was tracked via Western blotting using the GTU88 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... FLAG-tagged proteins were released from the resin by incubation with buffer supplemented with 50 mM FLAG peptide (Genscript, Piscataway, NJ) for 30 min.
-
bioRxiv - Immunology 2019Quote: ... V3P and PF as well as control peptides NP366 (ASNENMETM) and P18-I10 (RGPGRAFVTI) were purchased from GenScript (Piscataway, NJ, USA). Antibodies 53-6.7 (anti-CD8α) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Microbiology 2020Quote: ... the cDNA for PbChiB2 (Fig. S1) and PbChiB4 (Fig. S1) without the signal peptide was synthesized and cloned into plasmid pET-14b (GenScript, USA). Plasmids were used to transform E ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... driven by pSurvivin and encoding both GLuc2 and CD:UPRT separated by the P2A self-cleavage peptide sequence (pSurvivin-GLuc2-P2A-CD:UPRT-PP) was designed in-house and built by Genscript (NJ, USA). Single-transgene pSurvivin-driven PPs were designed and made in-house using In-Fusion HD Cloning Kits (Takara Bio ...
-
bioRxiv - Immunology 2021Quote: EAE was induced in 8-week-old mice by subcutaneous immunization with 100 μg myelin oligodendrocyte glycoprotein (MOG35-55) peptide (GenScript Biotech) emulsified in complete Freund’s adjuvant (CFA ...
-
bioRxiv - Immunology 2020Quote: ... and cultured in the presence of Phl p 6 or the mutants (20µg/mL) or individual peptides of a 15mer library (GenScript, NJ, USA) with an offset of 3 amino acids (10µg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...
-
bioRxiv - Molecular Biology 2023Quote: ... the beads were washed thoroughly with the IP buffer and the bound proteins were eluted with 200 μg/ml Flag (DYKDDDDK) peptide (GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0-100 µM) (peptide-seq.: WHWLQLKPGQPMY) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Bioengineering 2019Quote: ... at 10 wt % solution (measured Young’s modulus at this condition21 corresponds with initial average measured elastic modulus of omental tissue45) with 2 mM of cell adhesion peptide GSPCRGDG (RGD, Genscript, Piscataway, NJ) and crosslinked with a 90 mM combination of the 1 kDa linear PEG-dithiol (JenKem ...
-
bioRxiv - Immunology 2019Quote: ... B10.RIII mice (female, 6 to 8 weeks old, n = 8) were immunized with 100 μg IRBP160-181 peptide (GenScript, Piscataway, N.J.) dissolved 100 μl PBS emulsified in 100 μl of complete Freund’s adjuvant ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Cell Biology 2019Quote: Protease-activated receptor 1 (PAR-1)-activating peptide (TFLLRNPNDK-NH2) was custom synthesized as the C-terminal amide with a purity of > 95% by Genscript (Piscataway, NJ). Scrambled-siRNA (Sc-siRNA ...
-
bioRxiv - Bioengineering 2019Quote: ... transferred onto PVDF membranes and probed with primary antibodies raised in rabbit against a synthetic PmHAS peptide (NDNDLKSMNVKGAS, amino acids 860 to 874, prepared by GenScript, Hong Kong) and/or a monoclonal mouse anti-FLAG M2 antibody (F3165 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The anti-Apl polyclonal antibody was generated in a rabbit against the KLH-conjugated Apl peptide ASEIAIIKVPAPIVC by Genscript (New Jersey, USA).
-
bioRxiv - Biochemistry 2020Quote: ... BiP at 50 μM was incubated for 6 h at 24°C with 1 mM ADP and 1.3 μM fluorescently labelled NR peptide (NRLLLTG carrying a fluorescein moiety at the N-terminus, custom synthesised by GenScript at >95% purity) (Yang et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... the binding sites on the sensors were saturated with P15 peptide (ALLLSAPRRGAGKK, biotinylated on the C-terminal lysine; custom synthesised by GenScript, Piscataway, NJ) solubilised at 100 nM in HKTTx solution (IV) ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then eluted with a single wash of gel filtration buffer supplemented with 150 μg/mL 3x-Flag peptide (Genscript cat. RP21087) and 20 μM GppNHP ...
-
bioRxiv - Immunology 2023Quote: Biotinylated monomers were produced by the NIH Tetramer Core Facility at Emory University (Atlanta, GA) using Mafa-A1*063 Gag386-394GW9 peptides purchased from Genscript (Piscataway, NJ). Mafa-A1*063 Gag386-394GW9 biotinylated monomers were tetramerized with streptavidin-PE (0.5mg/mL ...
-
bioRxiv - Biophysics 2023Quote: ... WT mGluR 2 and mGluR3 peptides encompassing the first 23 residues of each CTD (mGluR2:PQKNVVSHRAPTSRFGSAAPRAS, mGluR3:PQKNVVTHRLHLNRFSVSGTGTT) were purchased from GenScript (Piscataway, NJ) (>= 95% purity) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Immunology 2019Quote: ... the alginate was dissolved in MES (150 mM MES, 250 mM NaCl, pH 6.5) and covalently conjugated to RGD peptide (GGGGRGDY; GenScript USA Inc., Piscataway, NJ) using carbodiimide chemistry (NHS/EDC) ...
-
bioRxiv - Immunology 2022Quote: ... mice were intravenously injected with 0.1 mg (from a solution of 1mg/ml in PBS) of VP2121-130 (FHAGSLLVFM) or control E7 (RAHYNIVTF) peptide (GenScript, Piscataway, NJ, USA) into the tail vein.
-
bioRxiv - Immunology 2022Quote: Chronic progressive EAE was induced by subcutaneous immunization of female 6- to 8-week-old C57BL/6 mice (Janvier Labs, France) with 200 µL of a Myelin Oligodendrocyte Glycoprotein solution (200 µg,MOG35-55 peptide: Genscript, New Jersey, USA) emulsified in complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Immunology 2023Quote: ... with 0.1 mg/kg Env peptides[24] (Pep1|YLRDQQLLGIWG, Pep2|RQQQNNLLRAIEA, Pep3|VYYGVPVWKEA, Pep4|LWDQSLKPCVKLT, Pep5|SVITQACSKVSFE, Pep6|GTGPCTNVSTVQC, Pep7|YKVVKIEPL, GenScript, New Jersey, U.S.) to establish low immunity during prime and boost (before 11 weeks) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2022Quote: Twenty 15-mer peptides (Figure 1A) used in human and mouse T-cell stimulation experiments were chemically synthesized by Genscript (TFA removal, >85% purity). The peptides were dissolved in DMSO at 20 mg/mL (∼12 mM) ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Neuroscience 2021Quote: ... we used a custom rabbit polyclonal anti-mouse AQP4ex (a gift from Drs Frigeri and Nicchia) generated against the peptide DSTEGRRDSLDLASC within the mouse AQP4 carboxyl terminal extension (GenScript Biotech, Piscataway, NJ, USA) that has been shown to detect the extended AQP4 isoforms 21 ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...