Labshake search
Citations for GenScript :
451 - 500 of 815 citations for Transglutaminase 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Slc37a2 peptide antibodies were produced using the PolyExpressTM service by GenScript (New Jersey, USA).
-
bioRxiv - Biochemistry 2020Quote: ... All the peptides were custom-synthesized and HPLC-purified by GenScript (New Jersey, USA). Peptides were reconstituted with DMSO and stored at −20 ºC ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Immunology 2020Quote: Selected nonpeptides and LncRNA-derived peptides were in vitro synthesized by GenScript (Piscataway, NJ). Selected melanoma CG antigen-derived peptides were synthesized by the Peptide Synthesis and Antigen Discovery Core ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Biophysics 2022Quote: All the unmodified and acetylated histone peptides were purchased from GenScript (Piscataway, NJ, USA). The synthesized peptides were purified by HPLC to achieve 98% purity and present in lyophilized form with TFA salt ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... and supplemented with 5uL of 0.1mg/mL competence stimulating peptide (DSRIRMGFDFSKLFGK, synthesized by Genscript). Cultures were then incubated at 37°C and 5% CO2 without shaking for 45 minutes (GC1825 ...
-
bioRxiv - Neuroscience 2023Quote: ... Complex was eluted using wash buffer supplemented with 0.2 mg/ml Flag peptide (Genscript). Eluent was concentrated and injected to a Superdex 200 increase 10/300 GL column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Immunology 2023Quote: ... The HCoV-OC43 nsp12/nsp13 peptides were synthesized at greater than 95% purity (GenScript).
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Immunology 2024Quote: ... and 2cz cultured with 50 ng/ml of its strong agonist peptide SIYRYYGL (GenScript) were used as a positive control (Matheoud et al. ...
-
bioRxiv - Biochemistry 2024Quote: All peptides in their Nt-Met and Nt-fMet forms were synthesized by GenScript. For oxidation experiments ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Biophysics 2020Quote: The peptide with 25 repeats of proline-arginine (PR25) was purchased from GenScript (Hong Kong). PR25 was dissolved in water and then mixed with polyU at final concentration 100 μM and 1 μg/μl respectively to induce the LLPS.
-
bioRxiv - Bioengineering 2020Quote: ... SIINFEKL peptide used in OT1 experiment and for ex vivo stimulation was purchased from Genscript.
-
bioRxiv - Biophysics 2019Quote: ... The PDZ system uses 20-50 µM of “elution peptide” (NH2-WETWV-COOH from GenScript). After the second column ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-biotinylated synthetic peptides (ctrl, pY, or Y816A; Genscript, USA, sequences described in figure 1h) of the last 26 amino acids (aa ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were arrested in G1 by addition of 10 µg/ml alpha factor peptide (Genscript) for 1.5 hrs ...
-
bioRxiv - Cell Biology 2021Quote: The synthetic peptides (Ac-DDDIAALC, Ac-EEEIAALC, DDDIAALC, EEEIAALC) were synthesized by GenScript (Piscataway, NJ). The DNPEP and ENPEP proteins were purchased from OriGene (Cat# ...
-
bioRxiv - Genetics 2022Quote: The SpyTag stock solution was prepared by dissolving synthetic SpyTag (Genscript custom peptide synthesis service) in water at a concentration of 1mM ...
-
bioRxiv - Immunology 2022Quote: ... The following peptides were used for T cell stimulation in ICS assays: Trp1 (NTPQFENL, GenScript), Trp2 (SVYDFFVWL ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Biochemistry 2019Quote: ... 26S proteasome was eluted with 26S lysis buffer + 0.5 mg/mL 3X FLAG peptide (Genscript). FLAG eluate was cleaved with HRV protease added in excess ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Plant Biology 2021Quote: ... the SGQKPLTLAEFTIGGSQ peptide was synthesized and polyclonal antiserum was raised in rabbit (GenScript, Tokyo, Japan). Anti-rabbit IgG horseradish peroxidase-linked antibody (Promega ...
-
bioRxiv - Biochemistry 2021Quote: A peptide corresponding to the C-terminal 28aa of Nbs1 (Nc28) was purchased from Genscript and dissolved in 100mM HEPES pH 7.4 to a concentration of 2mM as measured by 205nm absorbance ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal short XIRP2 antibody (custom generated against the immunizing peptide NSKRQDNDLRKWGD, Genscript, 1:100), mouse monoclonal IgG1 γ-actin antibody (1-24 ...
-
bioRxiv - Cancer Biology 2022Quote: A total of 376 predicted and mass-spec identified neoantigen-derived peptides were synthesized (GenScript) and each was added to 6 of 11 peptide pools such that each neoepitope (or group of similar neoepitopes ...
-
bioRxiv - Immunology 2022Quote: ... Both crude (∼50% purity) and purified (>95% purity; TFA removed) peptides were synthesized by GenScript USA ...
-
bioRxiv - Bioengineering 2023Quote: ... buffer at pH 9 was functionalized with a thiolated cell-adhesive RGD peptide (GenScript, GCGYGRGDSPG) via a Michael-type addition reaction ...
-
bioRxiv - Zoology 2023Quote: ... The AedaeACP (pQVTFSRDWNAa) and AedaeAKH (pQLTFTPSWa) peptides were commercially synthesized (purity >90%; Genscript, Piscataway, NJ) and diluted in BSA assay media (0.1% BSA in DMEM ...
-
bioRxiv - Molecular Biology 2023Quote: The synthetic peptides containing the 8-residue long LC8 binding motifs were ordered from Genscript Ltd ...
-
bioRxiv - Bioengineering 2023Quote: ... The crosslinker solution was prepared by dissolving the MMP-cleavable peptide (Ac-GCRDGPQGIWGQDRCG-NH2, GenScript) in distilled water at 12 mm and 10 μm Alexa-Fluor 647-maleimide (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2011) or fluorescein Piccolo-peptides (fluor-IEDEEKPVDLTAGRRA) were synthesized and purified (>90% purity) by GenScript. Peptides were solubilized and frozen as a stock solution of 20 mM in water and diluted to a final concentration of 10 µM.
-
bioRxiv - Bioengineering 2023Quote: ... dLN cells were restimulated in vitro in the presence of either OVA257-264 peptide (Genscript) at a final concentration of 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... the coding sequences (CDS) of target SP and CT peptides were commercially synthesised (IDT, GenScript) as fragments codon-optimised for expression in E ...
-
bioRxiv - Biochemistry 2023Quote: ... Synthetic peptides corresponding to Npm2 A2 and glutamylated counterparts were obtained from GenScript (Piscataway, NJ). The Npm2 119-146aa peptide was purified as previously described 9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli codon-optimized 10xHis- PPEP-4 (lacking the signal peptide) construct was ordered from GenScript. The pET-16b 10xHis-PPEP-4 plasmid was transformed to E ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Cell Biology 2024Quote: ... aureus auto inducer peptide (AIP) of 98% purity was purchased from GenScript (Piscataway, NJ, USA). Keratinocyte growth medium-2 (KGM-2 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Plant Biology 2021Quote: ... This polyclonal antibody was raised in rabbits against a synthetic peptide (CKTYLGRPWKEYSRT) (Genscript, Piscataway, NJ, USA) that includes the highly conserved amino acid sequence including residue in the catalytic site of PMEs (Markovič and Janeček ...