Labshake search
Citations for GenScript :
601 - 650 of 690 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...
-
bioRxiv - Neuroscience 2023Quote: The riboprobes were synthetized from 2 clones that were purchased from Genscript or obtained by BBSRC ChickEST Database (Boardman et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... The gene encoding NB4 mutant 2 (L13S, Q15D, K45D, K66D) was synthesised (GenScript), amplified and cloned into the pHEN6c expression vector ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Molecular Biology 2022Quote: The sequence for Rab7A (residues 2-176, uniprot P51149) was purchased from Genscript, N-terminally fused to a His tag and tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... and were cultured in the presence of 10 ng/mL IL-2 (Genscript #Z00368), and the presence or absence of TNFα (100 ng/mL ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated with HBSS containing or not 2 nM VEGF-A165 (Genscript, Piscataway, NJ) for 5 min at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM CaCl2) using 10 U of Recombinant Bovine His6-Enterokinase (GenScript, Piscataway, NJ, USA) overnight at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... The clarified supernatant was incubated overnight with 2 ml anti-DYKDDDDK G1 Affinity Resin (Genscript) at 4°C by batch binding ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... dissolved in sterile H2O at 10mM) and BcNEP2 (Botrytis cinerea Necrosis and Ethylene-inducing protein 2; AIMYSWYMPKDEPSTGIGHRHDWE, Genscript www.genscript.com ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... The filtered supernatant was mixed with 2 mL slurry of previously washed and equilibrated Glutathione Sepharose 4B beads (GenScript). After incubation ...