Labshake search
Citations for GenScript :
551 - 600 of 690 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs coding for NSP8 and NSP7 proteins were codon-optimised and custom-synthesised with an N-terminal 6X-His tag in the pET28a vector (Figure S1, GenScript, USA). The NSP12 ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids for codon-optimized pET-28a- His6-nsp7-8 and pET-28a-His6-nsp7-11 (with an HRV 3C protease cleavage site between the 6x- His tag and the coding sequence) were obtained from GenScript (Piscataway, NJ). Primers used for cloning and mutagenesis ...
-
bioRxiv - Biochemistry 2021Quote: ... plasmid containing the full-length Arabidopsis thaliana Atm3 (AtAtm3) gene with a C-terminal 6x-His tag was purchased from Genscript (Genscript, NJ). Mutagenesis reactions generating the N-terminal 60 ...
-
bioRxiv - Biochemistry 2020Quote: ... fused to the Saccharomyces cerevisiae alpha factor secretion signal (N-terminal)40 followed by a C-terminal Sortase-A recognition sequence and a His6 tag (C-terminal) was synthesized and cloned into pPICZalpha by GenScript (NJ, USA) using EcoRI and SacII restriction sites to produce pPICZalphaA-RBD-Hisx6.
-
bioRxiv - Biochemistry 2020Quote: ... and followed by a C-terminal Sortase-A recognition sequence for covalent coupling39 and a His6 tag for purification (LPETGHHHHHH) was synthesized by GenScript (NJ, USA) and cloned into the pCDNA3.1(+ ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs were then cloned into pET-15b such that the expressed proteins would contain an N-terminal His-Tag (GenScript, Piscataway, NJ). Transformation of competent DH5α E ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Bioengineering 2022Quote: ... The DNA construct was assembled as follows: the PSR1 gene (Cre12.g495100.t1.1) with an inserted 3xHA-tag was synthesized (Genscript Biotech Corporation, UK) and cloned into pUC57 via the StuI restriction site ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Microbiology 2022Quote: ... codon optimized genes encoding each PcaLOOL were obtained as subcloned in pPICZαA plasmids with a C-terminal 6 x His tag (GenScript, Piscataway, NJ, USA). P ...
-
bioRxiv - Neuroscience 2023Quote: The DNA sequences of Atg9 and Lamp1 were synthesized and subcloned into pUAST-attB vector containing a EGFP or a mCherry epitope tag by Genscript (Nanjing, China). Fly microinjection was conducted by the Drosophila Core Facility ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Microbiology 2022Quote: ... Heterologous expression was detected by electroblotting SDS-PAGE Tris-glycine gels onto nitrocellulose membranes and immunostaining with primary rabbit anti-His-tag antibody and secondary goat anti-rabbit IgG phosphatase alkaline conjugated antibody (GenScript, Piscataway, NJ, USA) (Suppl ...
-
bioRxiv - Biochemistry 2022Quote: ... as a C-terminal fusion to an N-terminal small ubiquitin-related modifier (SUMO) tag using BsaI and XhoI (GenScript, Piscataway, NJ, USA). This results in a construct that ...
-
bioRxiv - Bioengineering 2024Quote: Genes encoding the designed protein sequence were synthesized and cloned into pET-24a(+) E.coli plasmid expression vectors (Genscript, C-terminal 6X His tag). Plasmids were then transformed into chemically competent BL21(DE3 ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Immunology 2019Quote: ... KHNYN-2 (NM_001290256) was synthesized by GenScript. KHNYN-1 was cloned by amplifying the nucleotides 123-2157 from KHNYN-2 and sub-cloning the PCR product into the pcDNA3.1 (+ ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of reporter (1000 nM, GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2023Quote: ... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of 800 nM LwaCas13a (Genscript), 1 μL of a 1.6 μM target-specific Cas13 crRNA ...
-
bioRxiv - Biochemistry 2024Quote: WT-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-2/PD40693), N112C-CCNE1-3xFLAG (GenScript ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Immunology 2024Quote: ... 50 ng/mL of IL-2 (Z02764, GenScript), 10 ng/mL of IL-4 (HY-P70653 ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...