Labshake search
Citations for GenScript :
251 - 300 of 457 citations for Rat TUT1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Neuroscience 2023Quote: AAV9 and the BI-hTFR1 Rep-Cap plasmids were generated by gene synthesis (GenScript). The CAG-WPRE-hGH pA backbone was obtained from Viviana Gradinaru’s lab through Addgene (#99122) ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2024Quote: Wildtype (6x)His-MBP-EWSR1 gene was commercially synthesized in a pUC19 plasmid (Genscript). His-MBP-EWSR1 was inserted into a modified pGEX-6P-2 expression vector by restriction cloning with BsiWI and EcoRI restriction enzymes ...
-
bioRxiv - Immunology 2024Quote: Cxcr6 expressing plasmid was generated by cloning Cxcr6 gene block amplified from ORF (GenScript) into MSCV-IRES-GFP backbone (Addgene # 20672) ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Immunology 2024Quote: ... All segments were cloned into a bi-directional transcription plasmid derived from pUC57 (Genscript) including polymerase (Pol ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: A plasmid containing the bacterial codon optimized sequence of ORF11-338 was synthesized by GenScript in the pUC57 cloning vector (Supporting Material) ...
-
bioRxiv - Genomics 2022Quote: Synthesised promoter sequences were ordered as plasmids containing att sites for Gateway cloning from GenScript, and reporter transgenes constructed using three-site Gateway cloning (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript). To express and isolate recombinant TcsL ...
-
bioRxiv - Evolutionary Biology 2022Quote: DNA library containing seven random nucleotides was designed and cloned into pUC18 plasmid by Genscript. This random library was transformed in XL1blue E ...
-
bioRxiv - Immunology 2021Quote: ... VH sequences were also cloned into plasmids containing the IgA1 or IgA2 constant region (Genscript). Recombinant IgA was expressed without a J chain (to express only monomeric IgA ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid with codon optimized GCaMP7b under the EF1a promoter was constructed by GenScript (www.GenScript.com). Injections were performed as previously described72 with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid encoding for SARS-CoV-2 RBD was synthesized commercially (Genscript, Piscataway, NJ, USA). Recombinant RBD proteins were produced in transfected FreeStyle 293F cells (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Bacterial optimised expression plasmids for Ym1 and Ym2 were purchased from (Genscript, Piscataway, NJ, USA). Plasmids were then transfected into competent E ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Cell Biology 2022Quote: Tg-FLAG in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pcDNA3.1+-C-(K)-DYK plasmid expressing Flag-EBP was purchased from GenScript (#OHu18817). Primers for site-directed mutagenesis of the EBP gene were designed using the QuikChange Primer Design Program (https://www.agilent.com/store/primerDesignProgram.jsp?_requestid=1072141 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Genomics 2023Quote: The ACE2 coding sequence was synthesized by PCR amplification from the pUC57-ACE2 plasmid (GenScript). We included a NheI restriction site at the 5’ terminus and a PmeI restriction site at the 3’ terminus ...
-
bioRxiv - Biochemistry 2023Quote: ... The Galectin1 and Endo F3 gene were synthesized and cloned to pET28a plasmid by GenScript Corporation ...
-
bioRxiv - Immunology 2019Quote: ... The plasmids with rMIC1-T126A/T220A and rMIC4-K469M were synthesized by GenScript (New Jersey, US) using a pET28a vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The guide RNAs were cloned into the enhanced specificity CRISPR/Cas9 plasmid (eSpCas9-LentiCRISPR, v2, Genscript) (26) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids carrying single and double mutations were generated and sequence-verified by GenScript (Piscataway, NJ, USA). The numbering of the mutants refers to the sequences with the signal peptide included.
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding human codon-optimized spike genes with the desired mutations were purchased (GenScript, Piscataway, NJ). Supernatants containing pseudoviruses were collected 48 h post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid encoding the Spike of theB.1.1.7 variant was codon-optimized and synthesized by Genscript.
-
bioRxiv - Developmental Biology 2019Quote: ... All iOn and control piggyBac vectors were assembled in a pUC57-mini plasmid backbone (Genscript Inc) using a combination of DNA synthesis (Genscript Inc) ...
-
bioRxiv - Bioengineering 2019Quote: ... The plasmid pUC57 containing the flanking sequences of the gene aceA was purchased from GenScript (USA) and further linearized using the primers JL18-1 and JL18-2 ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid from the Baric system which contained the ZIKV E gene was modified by GenScript to include the Y61F ...
-
bioRxiv - Molecular Biology 2020Quote: ... while a plasmid standard from a synthetic construct of the P74 gene of SGHV from GenScript was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Immunology 2021Quote: ... plasmids encoding cDNAs for the heavy and light chain sequences of PhtD3-IgG2a were synthesized (GenScript), and cloned into pCDNA3.1+ ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... The uLimch1 and mLimch1 sequences were cloned into the backbone of a pcDNA3.1 plasmid by GenScript. Transfected cells were incubated in antibiotic free DMEM supplemented with 10% FBS for 48 hours ...
-
bioRxiv - Biophysics 2023Quote: ... Glu50Ala (E50A) and Asp94Ala (D94A) mutations were generated in the pcDNA3.1-mGL-picALuc plasmid (GenScript, Singapore). For generating the picSm and picSm-GCN4 fragment expressing plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... For viruses requiring a packaging plasmid each flask was transfected with 2.5 μg of pMDG (Genscript), 2.5 μg of p8.91 (encoding Gag-Pol ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Immunology 2023Quote: ... standard curves were generated using a synthetic plasmid containing a segment of the E-gene (GenScript) and interpolation was performed as described by Feld et al.71 ...
-
bioRxiv - Biochemistry 2023Quote: ... The empty vector control and specific point mutations of this plasmid were also generated by GenScript. Plasmids were transformed with Invitrogen’s One Shot Top10 chemically competent cells ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were either constructed by Gibson assembly17 or synthesized and cloned by Genscript (see Table S2). The vector for all plasmids was pHERD-30T17–19,65 and Genscript cloned the inserts using SacI and SalI ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid encoding human Kv5.1 with a C-terminal GFP tag was generated by Genscript. The Kv5.1BBS construct was generated at Genscript by inserting a bungarotoxin-binding site (GGWRYYESSLLPYPDGG ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Microbiology 2020Quote: pPB-NSP5-SV5-Csy4 and pPB-SV5-Csy4 plasmids were obtained from a GenParts DNA fragment (Genscript) containing NSP5-SV5-Csy4 and SV5-Csy4 and inserted in the pPB-MCS vector (VectorBuilder ...
-
bioRxiv - Cell Biology 2022Quote: The full length WWP2 plasmid (NM_001270454.1) was ordered in pcDNA3.1 with XhoI/XbaI cloning sites (Genscript Biotech). The plasmid was digested and inserted into the XhoI/XbaI sites of the pLV-CMV-IRES-eGFP lentiviral backbone (kindly provided by Prof ...