Labshake search
Citations for GenScript :
201 - 250 of 849 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Cell Biology 2020Quote: We obtained mouse TMEM16K cDNA from Genscript (Clone ID ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Plant Biology 2022Quote: ... mouse anti-Flag (A00187, GenScript, Piscataway, NJ), rabbit anti-histone H3 (A01502 ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Genetics 2023Quote: ... A plasmid containing mouse Pax1 (GenScript; OMu21524) was used as template for DIG-labeled probes ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... BG505 SOSIP.v4.1 expression constructs in which all PNGS were mutated to either NxT (NxT protein) or NxS (NxS protein) were obtained from Genscript and cloned in the pPPI4 expression vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The anti-Mps1 antibodies were generated in rabbits against a recombinant Mps1 protein fragment (residues 440-764) of the protein by Genscript. The company provided affinity purified antibodies that we validated by purifying kinetochores from yeast strains with Mps1 or Mps1-13Myc and confirming that the antibody recognized a protein of the correct molecular weight that migrated more slowly with the 13Myc epitope tags ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-Scm3 antibodies were generated in rabbits against a recombinant Scm3 protein fragment (residues 1-28) of the protein by Genscript. The company provided affinity-purified antibodies that we validated by immunoprecipitating Scm3 from yeast strains with Scm3-V5 and confirming that the antibody recognized a protein of the correct molecular weight that was also recognized by α-V5 antibody (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Molecular Biology 2022Quote: ... All custom recombinant proteins were synthesised by GenScript using a mammalian expression system.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Immunology 2019Quote: Recombinant microbial protein synthesis was performed by Genscript Corporation (http://www.genscript.com/ ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with recombinant protein (GenScript, Sigma, Tocris) of each analyte for 4 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membrane (Genscript) by the Genscript eBLOT L1 fast wet protein transfer system ...
-
bioRxiv - Microbiology 2020Quote: ... The protein was cleaved using bovine enterokinase (GenScript) leaving a FLAG-tag at the C-terminus of the RBD ...
-
bioRxiv - Immunology 2022Quote: ... or S-protein peptide pool (Genscript, # RP30020, USA) or S-protein (B.1.351 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-RHDV RdRp was prepared by Genscript and stored in our laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA of mouse Tia1 was purchased from GenScript in pcDNA3.1 vectors (clone ID ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: ... mouse and rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Genetics 2021Quote: ... We followed up with Mouse anti His6 (Genscript), rabbit anti-HA-PE (Cell Signaling Technology) ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti FLAG-tag (1:500; A00187, GenScript). Anti-rabbit and anti-mouse secondary antibodies coupled to Alexa-488 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse PANX1 (UniprotID: Q9JIP4) was synthesized by GenScript and subcloned into the pEGC Bacmam vector(41) ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with Biotin-Protein L (Genscript) followed by fluorescently-conjugated streptavidin.
-
bioRxiv - Cell Biology 2021Quote: ... Cas9 protein was purchased from Genscript (Cat. No. Z03389). Cas9 protein (12 µg ...
-
bioRxiv - Immunology 2022Quote: Plasmids encoding cDNAs of Pneumovirus proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector (30 ...
-
bioRxiv - Immunology 2022Quote: ... and protein G resin (L00209) were purchased from GenScript. Anti-NLRP3 (AG-20B-0014-C100 ...