Labshake search
Citations for GenScript :
101 - 150 of 849 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Biophysics 2022Quote: The fluorescence-based binding assay employed chemically synthesized unlabeled RNA constructs (wt and mutants) prepared in-house and a peptide mimic (Genscript) of the Tat RNA binding domain N-AAARKKRRQRRR-C containing the arginine rich motif (ARM) ...
-
bioRxiv - Immunology 2023Quote: A commercially available kit to quantify the ability of the three pAbs to neutralize the binding of RBD to ACE-2 was obtained from GenScript, Piscataway NJ (kit #L00847) ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse (GenScript™) followed by 1:4000 Goat Anti-Mouse IgG Antibody (H&L ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Adherent cells were then cultured with complete maturation media (RPMI-1640 with 10% FBS, penicillin/streptomycin, 10 ng/ml macrophage colony-stimulating factor (M-CSF) (Genscript) for 5 days for monocyte-derived macrophages (MDM ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An elongation factor EF-P (GeneFrontier Corporation) and synthesized SKIK peptide dissolved in nuclease-free water (94.6% purity, GenScript, Tokyo) was added to achieve a final concentration of 1 µM and 100 µM ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50,000 cells were transferred to 300 µL volumes comprising a 10-fold dilution series of ɑ-factor (0-100 µM) (GenScript) dissolved in SC+1%DMSO ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0-100 µM) (peptide-seq.: WHWLQLKPGQPMY) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0- 1 µM) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Biochemistry 2022Quote: ... of the human CRX protein was fused to a 6x His-tag inserted following the met start codon and subcloned into the commercial PMAL-c5x expression plasmid containing a maltose binding domain (MBD) coding sequence using Xmnl and EcoR1 restriction sites (GenScript, Piscataway, NJ). CRX DBD-MBD plasmid was transformed into BL21 E ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 10 amino acid sequences covering the four reported binding sites on the clathrin terminal domain (see Fig. 7A) were synthesized by GenScript (Piscataway, NJ) with > 95% purity ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse GPx2 plasmid (GenScript) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 30 °C in YP medium supplemented with adenine and either 2% raffinose (inducible G1 replication system) or 2% glucose (sporadic G1 replication system) and synchronized in G1 by adding α-factor (MPIB core facility or GenScript RP01002) to a final concentration of 0.5 µg/ml for bar1Δ cells or 10 µg/ml for BAR1 cells ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-V5 (Genscript); 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or mouse (GenScript Z02767-10) IL-6 or w/o.
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GST (GenScript ; #A00865) and mouse anti-V5 (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse cytochrome b561 (NM_007805.4, Genscript) and pcDNA3-SypHluorin2 (#37005 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse IL11 (mIL11, Z03052, Genscript).