Labshake search
Citations for GenScript :
351 - 400 of 1195 citations for C Reactive Protein CRP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... anti-sera were generated against His-tagged HAUS1 and C-terminal fragment HAUS6 as well (Genscript). All custom-made antibodies were purified from serum with an antigen-coupled matrix (Affi-Gel 10 or 15 ...
-
bioRxiv - Biophysics 2019Quote: A synthetic peptide from CPSF6 comprising residues 313-327 with a C-terminal cysteine (PVLFPGQPFGQPPLGC, Genscript) was dissolved (1.85 mM ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Genetics 2023Quote: The expression vector for C-terminally Flag-tagged full-length human GDF15 was obtained from Genscript. The C211G mutant was generated by site-directed mutagenesis of the wild-type vector using the QuikChange II protocol (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescein amide-labeled SSB C-terminal peptide (5-FAM WMDPDDDIPF) was synthesized and purified commercially (GenScript).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... FAM177A1-Halo and FAM177A1-SNAP are all cloned fromFAM177A1 pcDNA3.1+/C-(K)-DYK (GenScript Clone ID:OHu30351D) using the primers in (Table S1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid encoding human Kv5.1 with a C-terminal GFP tag was generated by Genscript. The Kv5.1BBS construct was generated at Genscript by inserting a bungarotoxin-binding site (GGWRYYESSLLPYPDGG ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bound proteins were eluted with Flag peptide (200 μg/ml; GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ligated in place of the C terminus of the full-length CLEC16A isoform construct (OHu18264D; Genscript). To generate the CLEC16A mutant bearing only the internal deletion of the CLEC16A disease isoform ...
-
bioRxiv - Neuroscience 2019Quote: ... a siRNA sequence targeting the SULT4A1 C-terminus was designed following GenScript siRNA Target Finder instructions (GenScript). Nucleotide sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Monoclonal anti-CodY antibody was generated by injection of CodY into the BALB/C mouse (Genscript, USA). Mouse anti-CodY IgG monoclonal antibody (IgG ...
-
bioRxiv - Biophysics 2021Quote: ... and cloned into pET28b expression vectors with a C-terminal 6x histidine-tag (6xHis-tag) by Genscript USA Inc ...
-
bioRxiv - Biochemistry 2022Quote: The 10 C-terminal residues of Caulobacter crescentus RNase E (EKPRRGWWRR) (GWW peptide) were synthesized by GenScript with C-terminal amidation and dissolved in Milli-Q water ...
-
bioRxiv - Neuroscience 2022Quote: ... XM:006510629.3 ORF sequence) cDNAs cloned into the pcDNA3.1+/C-(k)-DYK vectors were obtained from GenScript. For the electrophysiological recordings of the Na+ currents ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transiently transfected with a pcDNA3.1 vector that expressed a C-terminally Flag-tagged AFG3L2 (GenScript) with the indicated single-point mutations ...
-
bioRxiv - Biochemistry 2019Quote: ... P116A/Y117Q and P142A/Y143Q mutants with a C terminal FLAG tag were synthesized by Genscript (genscript.com).
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Neuroscience 2023Quote: ... the complete open reading frame of mouse NaV1.7 was cloned into the pcDNA3.1(+)-C-DYK vector (GenScript) with several modifications ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Physiology 2024Quote: ... Human HSD17B13 (NCBI Accession number: NM_178135.5) with HA-tag on the C-terminus was cloned into pcDNA3.1 (Genscript). HEK293 cells and HepG2 cells were transfected with HSD17B13 or empty control vector using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2023Quote: The open reading frame of full-length human GPNMB (NM_001005340.2) cloned into pcDNA3.1-C-EGFP was purchased from GenScript. pcDNA3.1-GPNMB-EGFP-G375V ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...