Labshake search
Citations for GenScript :
151 - 200 of 1195 citations for C Reactive Protein CRP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Biophysics 2021Quote: ... CCKAR–G protein complexes were assembled at room temperature (RT) for 1 h by the addition of 10 μM CCK-8 (GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAR T cells were evaluated for CAR expression on the surface by flow cytometry with protein L (1:100; M00097, Genscript) as previously described(47) ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Immunology 2020Quote: ... 1mL of day 56 serum was diluted to 10 mL with PBS and incubated with 1 mL of 3x PBS washed protein A beads (GenScript) with agitation overnight at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured at 5e5 cells/well with two peptide pools representing the full-length S protein at 1 μg/ml (Genscript) overnight in order to stimulate the cells ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Plant Biology 2023Quote: ... nucleotides 1–468) and C-terminal (VC; nucleotides 469–724) fragments of the Venus I152L variant 54 were synthetized by GenScript (Piscataway, NJ, USA). In all cases a CAT codon coding for an extra Histidine residue was added to the sequences after the first ATG start codon in order to generate NsiI restriction sites (ATGCAT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... fused to the Saccharomyces cerevisiae alpha factor secretion signal (N-terminal)40 followed by a C-terminal Sortase-A recognition sequence and a His6 tag (C-terminal) was synthesized and cloned into pPICZalpha by GenScript (NJ, USA) using EcoRI and SacII restriction sites to produce pPICZalphaA-RBD-Hisx6.
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Biochemistry 2022Quote: ... And then Protein A beads (GenScript) were used to separate Fab fragments ...
-
bioRxiv - Immunology 2022Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The following day ...
-
bioRxiv - Immunology 2021Quote: ... and AmMag Protein A beads (Genscript) or loaded on a protein A (Cytiva ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a multi-tag protein standard (Genscript) was serially diluted in 1xTBS with 0.5% Tween-20 buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein G coated MagBeads (Genscript #L00274) were equilibrated with Binding/Wash Buffer (20mM Na2HPO4 ...
-
bioRxiv - Biochemistry 2023Quote: ... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
bioRxiv - Microbiology 2020Quote: ... MgrB or SafA C-terminal peptides (synthesized by Genscript) were added to the culture with indicated amount ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... cell-based expression system and RBD proteins were purified using Protein A affinity resin (Genscript Cat#: L00210). Protein purities were assessed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Microbiology 2021Quote: ... Selected small proteins and small protein derived peptides from high-and medium observed abundance were chemically synthesized (Genscript) and subjected to LC-MS/MS as above ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Bioengineering 2019Quote: ... The VHPKQHR(MiniPEG1)C peptide was from Genscript (≥ 95% purity). Water was purified using a Millipore Milli-Q Synthesis purifier (18.0 MΩ cm ...
-
bioRxiv - Cancer Biology 2022Quote: ... plenti CRISPR v2 virus against sgRNA targeting c-MYC (Genscript) and plenti CRISPR v2 virus (control ...
-
bioRxiv - Biophysics 2020Quote: CPSF6 peptide (P313-G327) with C-terminal cysteine (PVLFPGQPFGQPPLGC, Genscript) and FEZ1 peptide (M174-L188 ...
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... fused at its C-terminus to eGFP (synthesized by GenScript), was cloned into piggyBac-Tre-Dest-rtTA-HSV-neo plasmid ...
-
bioRxiv - Immunology 2023Quote: ... YAP1 and Mid1 with C-terminal Flag were synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminally FLAG tagged constructs in pcDNA: PFD3 (GenScript, NM_003372), PFD5 (GenScript ...
-
bioRxiv - Microbiology 2020Quote: ... and purified with protein A resin (GenScript) and by Ni-NTA resin (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and biotinylated Protein A mixture (GenScript #M00095) was diluted 42 fold to 240 nM in 1x PBS with 0.0025% Tween 20 ...
-
bioRxiv - Cell Biology 2020Quote: ... NeutrAvidin and biotinylated Protein A (GenScript #M00095) were mixed in a 1:1 ratio to a final concentration of 10 μM and stored at 4 °C ...
-
bioRxiv - Genomics 2019Quote: ... Protein was generated by GenScript (Piscataway, NJ) and purified to >80% purity ...
-
bioRxiv - Cell Biology 2021Quote: Commercial recombinant proteins: rhIL11 (UniProtKB: P20809, Genscript), rmIL11 (UniProtKB ...