Labshake search
Citations for GenScript :
1 - 50 of 1153 citations for 6 Heptenoic acid 7 2 cyclopropyl 4 4 fluorophenyl 3 quinolinyl 3 5 dihydroxy calcium salt 1 1 3R 5S 6E since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Microbiology 2023Quote: ... phage 1/4 Gad1 was used and synthesized by Genscript. Gad1 and related homologs were cloned into the pSG-thrC-Phspank vector40 and transformed to DH5α competent cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Cell Biology 2024Quote: MeHA hydrogels were formed from a 3% w/v MeHA macromer solution functionalized with 1 mM RGD peptide (GenScript) in 0.2 M Triethanolamine (TEOA ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...