Labshake search
Citations for GenScript :
251 - 300 of 1153 citations for 6 Heptenoic acid 7 2 cyclopropyl 4 4 fluorophenyl 3 quinolinyl 3 5 dihydroxy calcium salt 1 1 3R 5S 6E since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Molecular Biology 2019Quote: Samples were run on either 4-20% Express Plus PAGEs in Tris-MOPS-SDS running buffer (GenScript), 10% Criterion TGX gels (BioRad ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... OLP peptide pools of 15mers with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD (R319-S591, GenScript). Sequences that contained VOC mutations were exchangeable with the corresponding mutated peptides due to a modular OLP pool design.
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Immunology 2020Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire SARS-CoV-2 S protein (GenScript). After stimulation ...
-
bioRxiv - Immunology 2023Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit polyclonal antibody to Drosophila Rab6 3’UTR was acquired by immunizing the New Zealand rabbit with peptide NRLSRRSNHPLPLFC by GenScript company (Nanjing) ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Lysate supernatants were incubated overnight at 4°C with anti-flag monoclonal antibody coated on agarose beads (Genscript). The beads were then washed five times in wash buffer (50mM Tris-HCl pH 7.5 ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...