Labshake search
Citations for GenScript :
101 - 150 of 897 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.1 spike mutations (T95I, G142D, E154K, L452R, E484Q, D614G, P681R and Q1071H) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biophysics 2024Quote: Gene sequences for nsp7-11 and Mpro used were taken from “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1” as published in January 2020 (replaced by NCBI LOCUS NC_045512) and commercially synthesized (GenScript). The synthetic gene sequence for nsp7-11C and nsp7-11N with suitable overhangs were cloned with Type IIS restriction enzymes into either pASK35+ and pASK33+ (IBA life sciences) ...
-
bioRxiv - Microbiology 2021Quote: ... T1027I) and the B.1.526 lineage (L5F, T95I, D253G, E484K, D614G, A701V) were codon-optimized and synthesized by Genscript. The plasmids encoding the Spike from the B.1.617.1 (E154K ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with the 2P mutations and B.1.351 spike mutations (D80A, D215G, 242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag.
-
bioRxiv - Developmental Biology 2023Quote: ... or b) mRNA of either mCherry or GFP at 400ng/µl and ribonucleoprotein formed by Cas13a (GenScript, Piscataway, NJ) at 400 ng/µl and the corresponding targeting sgRNA at 400 ng/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Cell Biology 2020Quote: ... Ctdnep1-GFP and Ctdnep1 _D67E-GFP siRNA resistant sequences adding silent mutations for Ctdnep1 siRNAs #1 and #2 were synthesized (GenScript) and cloned directly to pcDNA3.1(+)-C-eGFP vector.
-
bioRxiv - Microbiology 2020Quote: The SARS-CoV-2 S gene from the Wuhan-Hu-1 isolate (GenBank: MN908947.3) was codon optimized (Genscript, Township, NJ) and cloned in pMD2iPuror in EcoRI/XhoI ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before being exposed with 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) at different times (5 ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Developmental Biology 2021Quote: ... The shRNA sequences were cloned into the RCAS vector (Supplementary Fig. 2A,B) by homologous recombination using a CloneEZ kit (GenScript) as previously described (Kwiatkowski et al. ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Immunology 2020Quote: ... Pseudotyped SARS-CoV-2-S (Genscript), full-length recombinant S protein (Acrobio systems) ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...