Labshake search
Citations for GenScript :
1 - 50 of 897 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein B.1.1.529-Omicron (RP30121, GenScript Biotecn Corp, Piscataway, NJ) were used with the simultaneous control of the wild-type ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2022Quote: ... Delta (B.1.617.2) and Omicron (B.1.1.529) were synthesized by GenScript. The production of SARS-CoV-2 S pseudotyped vesicular stomatitis virus (VSV ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-biotinylated synthetic peptides (ctrl, pY, or Y816A; Genscript, USA, sequences described in figure 1h) of the last 26 amino acids (aa ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The B.1.429 RBD gene was synthesized by GenScript into pCMVR with the same boundaries and construct details with a mutation at L452R ...
-
bioRxiv - Immunology 2020Quote: ... Peptide-specific T cell lines were grown similarly using autologous irradiated BLCLs pulsed with 15-mers A3C-1 and A3C-B (GenScript).
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.526 Spikes were codon-optimized and synthesized by Genscript. Plasmids encoding B.1.617 ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.351 spike cDNA was synthesized (Genscript, Piscataway, NJ, USA). Pseudoviruses were generated in BHK-21/WI-2 cells using a pseudotyped ΔG-GFP (G*ΔG-GFP ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...