Labshake search
Citations for GenScript :
4301 - 4350 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Genes were synthesized and cloned into pET28a(+) vector by Genscript, and resuspended to 0.2μg/μL with ddH2O.
-
bioRxiv - Cell Biology 2021Quote: ... and tdTomato (Home-made; GenScript).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nine neuropeptides (synthesised by GenScript, USA) were diluted with 27.5 ppt ASW or deionised water according to the solubility test results provided by the manufacturer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gruberi were amplified from commercially synthesized templates (Genscript; for primers used for PCR amplification of the coding sequences see Supplementary Data 6 ...
-
bioRxiv - Genomics 2021Quote: ... sgRNA sequences were synthesized by Genscript flanked with OligoL (TGGAAAGGACGAAACACCG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Roll-your-own-structure’ challenge were ordered in the form of a custom oligonucleotide pool of DNA (Custom Array/Genscript) with the 20-nt T7 RNA polymerase promoter sequence (5’-TTCTAATACGACTCACTATA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized by GenScript and cloned into a modified pET28 vector incorporating an N-terminal hexahistidine tag and a TEV cleavage site ...
-
bioRxiv - Molecular Biology 2021Quote: ... All codon optimization was done by GenScript (Piscataway, NJ) using OptimumGene™ algorithms.
-
bioRxiv - Molecular Biology 2021Quote: ... melanogaster expression and synthesized (GenScript, Piscataway, NJ) were separately cloned in to generate the six final FAR protein-expressing vectors ...
-
bioRxiv - Molecular Biology 2021Quote: AngII and TRV023 (Sar-Arg-Val-Tyr-Lys-His-Pro-Ala-OH) were synthesized by GenScript USA (Piscataway ...
-
bioRxiv - Plant Biology 2021Quote: ... attB2: ggggaccactttgtacaagaaagctgggt and synthesized by GenScript. The fragment was cloned into the E ...
-
bioRxiv - Microbiology 2021Quote: ... pAb (GenScript), treated with Pierce™ ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2021Quote: ... Mouse (GenScript) followed by 1:4000 Goat Anti-Mouse IgG Antibody (H&L ...
-
bioRxiv - Genomics 2021Quote: ... NORAD was cloned into the pUC57 vector by GenScript Biotech (Netherlands) ...
-
bioRxiv - Immunology 2021Quote: ... The B.1.429 RBD gene was synthesized by GenScript into pCMVR with the same boundaries and construct details with a mutation at L452R ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV2 RBD-L452R construct California-B.1.429 (L452R) was synthesized by GenScript into CMVR with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific CD4+ and CD8+ T cell responses in NHP PBMCs were assessed by flow cytometry using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Briefly ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The designed gene was synthesized by GenScript (Nanjing, China) using a mammalian codon-optimized sequence for enhanced expression and then cloned into the mammalian expression vector pCDNA3.4 (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Immunology 2021Quote: ... All of other peptides were from GenScript. 3D structure of SARS-CoV-2 S protein (PDB code ...
-
bioRxiv - Immunology 2021Quote: ... Large-scale culture of supernatants and purification of antibodies was performed by Genscript.
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Immunology 2021Quote: ... cells were immunostained using a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058), anti-rabbit IgG peroxidase conjugate ...
-
bioRxiv - Immunology 2021Quote: ... Antigen experienced CD4+ T cells were generated in vitro by priming lymph nodes and splenocytes of CD45.1 Marilyn mice or Thy1.1 OT-II mice with respectively 10nM Dby (NAGFN-SNRANSSRSS, Genscript) and 5μM OVAII peptide (InvivoGen) ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized cDNA encoding the SARS-CoV-2 S1 domain fused to the C-terminal portion of the VSV glycoprotein was obtained from Genscript. The cDNA was cloned into the XhoI and NheI sites of a modified recombinant VSV vector containing an additional transcription start stop signal between the G and L genes (Wirblich et al. ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Immunology 2021Quote: ... All peptides were obtained at >85% purity from Genscript.
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was also modified by GenScript to include the include the Y61F ...
-
bioRxiv - Microbiology 2021Quote: ... Fragment A was modified by GenScript from thymine to guanine at nucleotide position 1599 and thymine to adenine at position 1601 to generate the Y61E phosphomimetic while nucleotide 1600 was modified from adenine to thymine for the Y61F non-phosphorylatable mutant ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-Loqs antibody (custom generated by GenScript), Anti-HA antibody (ab130275 ...
-
bioRxiv - Genetics 2021Quote: ... we ordered and subcloned an OR4D6 consensus sequence into the vector pCI-RHO (GenScript). pCI-Rho (Promega ...
-
bioRxiv - Genetics 2021Quote: ... The consensus amino acid sequence was printed by GenScript and subcloned into the pCI-Rho vector (Promega).
-
bioRxiv - Genetics 2021Quote: ... by GenScript (Suppl. Table S4). The Klhl13 isoform expressed in mESCs was used (ENSMUST00000115313.7) ...
-
bioRxiv - Microbiology 2021Quote: ... neoformans-optimized (Cno) Cas9 construct was ordered from GenScript (Piscataway, NJ) through their gene synthesis service and was received as an insert in pUC57 flanked by XbaI and BamHI restriction sites ...
-
bioRxiv - Immunology 2021Quote: EAE was induced in 8-week-old mice by subcutaneous immunization with 100 μg myelin oligodendrocyte glycoprotein (MOG35-55) peptide (GenScript Biotech) emulsified in complete Freund’s adjuvant (CFA ...
-
bioRxiv - Immunology 2021Quote: ... B16-F10 tumor neoantigen peptides were synthesized by GenScript (Piscataway, NJ). The sequences are as follows ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s instructions (Genscript). A SARS-CoV-2 pseudo-virus neutralization assay was performed with rat sera at the Israeli Central Virology Lab (Sheba Medical Center ...
-
bioRxiv - Immunology 2021Quote: ... by subcutaneous injection with 50μL S1 (Genscript) (50μg/rat ...
-
bioRxiv - Immunology 2021Quote: ... Mice receiving oral vaccine were administered a combination of S1 (GenScript), LTB-NN ...
-
bioRxiv - Immunology 2021Quote: ... Plates were coated overnight with 100 ng/well of S1 (Genscript) in coating buffer (0.015M carbonate/bicarbonate buffer ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Immunology 2021Quote: ... cells and synthetically produced by GenScript® service (GenScript USA, Piscataway, NJ, USA). The QuikChange® Lightning site-directed mutagenesis kit (Agilent Technologies ...