Labshake search
Citations for GenScript :
351 - 400 of 701 citations for Human KRT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Microbiology 2023Quote: ... Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively) were synthesized and cloned into pcDNA3.1+ (GenScript). All DNA constructs were verified by Sanger sequencing (ACGT) ...
-
bioRxiv - Genomics 2019Quote: ... Pax6 or Syt4 (RNA synthesis, subcloning and plasmid sequencing were performed by GenScript, Netherlands) (Figure 3-Supplementary data (2)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Microbiology 2021Quote: ... synthesized and cloned into the Gal-inducible plasmid pESC-URA by GenScript (Piscataway, NJ). Briefly ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Microbiology 2021Quote: The other transfer plasmids pΔEP153R-VP30mNG and pΔEP153RΔEP402R-VP30mNG were synthesized commercially (Genscript, US). Plasmid pΔEP153R-VP30mNG contains the left and right flanking regions of EP153R ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Microbiology 2019Quote: ... Primer synthesis and the sequencing of PCR products or plasmids were performed by Genscript Biotech (Nanjing ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA sequences ligated into pX458 (pSpCas9 BB-2A-GFP) plasmids were purchased from GenScript. Transfections were performed with TransitIT-293 (Mirus Bio ...
-
bioRxiv - Microbiology 2021Quote: A HMPV minigenome plasmid containing Gaussia/Firefly luciferases was designed and synthesized by Genscript, cloned in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... For the Delta variant a full-length plasmid was acquired from GenScript (Piscataway, NJ) and then truncated by in-house PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... BNIP3_OMu13517D or Cdc42_OMu16203C_cDNA expression plasmids were synthesized by a commercial entity (GenScript USA Inc). NDRG1_OMu19504D and BNIP3_OMu13517D were each cloned into a pcDNA3.1+/C-(K)-DYK vector ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids containing REDRAW constructs and guide RNA were either ordered and prepared by Genscript or cloned in house utilizing the Bioxp™ ...
-
bioRxiv - Neuroscience 2023Quote: AAV9 and the BI-hTFR1 Rep-Cap plasmids were generated by gene synthesis (GenScript). The CAG-WPRE-hGH pA backbone was obtained from Viviana Gradinaru’s lab through Addgene (#99122) ...
-
bioRxiv - Biochemistry 2024Quote: Wildtype (6x)His-MBP-EWSR1 gene was commercially synthesized in a pUC19 plasmid (Genscript). His-MBP-EWSR1 was inserted into a modified pGEX-6P-2 expression vector by restriction cloning with BsiWI and EcoRI restriction enzymes ...
-
bioRxiv - Immunology 2024Quote: Cxcr6 expressing plasmid was generated by cloning Cxcr6 gene block amplified from ORF (GenScript) into MSCV-IRES-GFP backbone (Addgene # 20672) ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Immunology 2024Quote: ... All segments were cloned into a bi-directional transcription plasmid derived from pUC57 (Genscript) including polymerase (Pol ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: Synaptopodin A was synthesized by Genscript using the coding sequence of human synaptopodin (NCBI Reference Sequence: NP_009217.3) and was subcloned by Genscript into HINDIII and Xho1 sites of the blasticidin-selectable mammalian expression vector pcDNA6 myc-HisA (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Biophysics 2020Quote: The Rh-PDE (full) gene (NCBI Gene ID: 16078606) was synthesized after human codon optimization (GenScript), as described previously13 ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2021Quote: Codon optimized constructs of the truncated versions of human Syx were designed and obtained from GenScript. Fusion constructs were generated as described previously(48 ...
-
bioRxiv - Cell Biology 2022Quote: Three subunits of the human mTORC1 complex (mTOR, Raptor, mLST8) were codon-optimized and synthesized (GenScript). The mTOR gene was cloned into a pCAG vector without a tag ...
-
bioRxiv - Immunology 2022Quote: ... The cells were cultured for 24 hours prior to being treated with: Human IL11 (UniProtKB:P20809, GenScript), human TGFβ1 (PHP143B ...
-
bioRxiv - Immunology 2022Quote: Antibody heavy and light chain genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (pCMV3-CH ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Genetics 2023Quote: The expression vector for C-terminally Flag-tagged full-length human GDF15 was obtained from Genscript. The C211G mutant was generated by site-directed mutagenesis of the wild-type vector using the QuikChange II protocol (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct consisting of human APP770 cDNA in the pcDNA3.1 backbone was custom made (GenScript, Piscataway) and then sequenced ...
-
bioRxiv - Neuroscience 2024Quote: ... 2000) was codon optimized for human cells and synthesized into a pcDNA 3.1(+) vector by Genscript. Codon-optimized G5A and Gqi5/9 sequences as well as cloning primers and further details are provided in Supplementary file 7.
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... Dabie Bandavirus (DBV) glycoprotein Gn gene (GenBank NC_018138.1) was codon-optimized for human codon usage (Genscript) and cloned into the expression vector ...
-
bioRxiv - Microbiology 2024Quote: ... The murine-human chimeric heavy and light chain sequences were then cloned into pGenDONR by GenScript, with a P2A sequence added between the heavy and light chain sequences to create the pGenDONR-IgG H1-P2A-Ig(λ ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: A plasmid containing the bacterial codon optimized sequence of ORF11-338 was synthesized by GenScript in the pUC57 cloning vector (Supporting Material) ...
-
bioRxiv - Genomics 2022Quote: Synthesised promoter sequences were ordered as plasmids containing att sites for Gateway cloning from GenScript, and reporter transgenes constructed using three-site Gateway cloning (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript). To express and isolate recombinant TcsL ...