Labshake search
Citations for GenScript :
451 - 500 of 701 citations for Human KRT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: The full length human KCNQ2 construct (NCBI Reference Sequence: NP_742105.1; GI: 26051264) was synthesized (GenScript USA, Piscataway, NJ) and ligated between the BamHI and XbaI sites in the multiple cloning site of into the pGEM-HE vector ...
-
bioRxiv - Cell Biology 2022Quote: ... ferritin L (Ft-L) made by using purified human ferritin L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2020Quote: ... GenBank: MN908947) construct for preparation of RBD-based nanoparticle vaccine were human codon-optimized and synthesized by Genscript, and further cloned into mammalian expression vector VRC8400 with a N-terminal Kozak consensus sequence ...
-
bioRxiv - Cancer Biology 2022Quote: Human RET-GFP and RET712-1114-GFP were cloned by PCR using a cDNA clone (GenScript Biotech; NM_020975.6) as template ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length wild-type human FLCN cDNA carrying an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript) ...
-
bioRxiv - Genetics 2020Quote: ... and CH3 genes of human immunoglobulin isotype IgG1 were added to the heavy chain variable region (Genscript, USA). Vectors that encoded the anti-FAM19A5-IgG1 antibody were transfected into HEK293F cells and the recombinant antibody was purified using Protein A beads (RepliGen) ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Cell Biology 2023Quote: The full length human arpin sequence cloned into the pET-32a(+) expression vector was from GenScript (Piscataway, NJ). The Arpin-pET-32a(+ ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Biophysics 2024Quote: The full length human KCNQ3 construct (NCBI Reference Sequence: NP_004510.1; GI:4758630) was synthesized (GenScript USA, Piscataway, NJ) and ligated between the BamHI and XbaI sites in the multiple cloning sites of into the pGEM-HE vector ...
-
bioRxiv - Immunology 2024Quote: ... the light chain immunoglobulin variable region sequences were inserted into the human kappa constant region sequence (Genbank accession number OM584289.1) and synthesised into mammalian vector pcDNA3.1 (Genscript). Human J chain was also synthesised into mammalian vector pcDNA3.1 ...
-
bioRxiv - Bioengineering 2024Quote: ... iFluor 647-conjugated anti-His-tag antibody (pilot CYpHER detection and TfR human/mouse cross-reactivity, Genscript A01802); Alexa Fluor 647-conjugated anti-Fc Fab (Surface protein and CYpHER quantitation ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides encoding residues 166–181 of human CHMP6 or various truncations of HCMV pUL71 were purchased from Genscript at >95% purity and the dry peptides were resuspended in ITC buffer to the desired concentration ...
-
bioRxiv - Microbiology 2020Quote: pPB-NSP5-SV5-Csy4 and pPB-SV5-Csy4 plasmids were obtained from a GenParts DNA fragment (Genscript) containing NSP5-SV5-Csy4 and SV5-Csy4 and inserted in the pPB-MCS vector (VectorBuilder ...
-
bioRxiv - Cell Biology 2022Quote: The full length WWP2 plasmid (NM_001270454.1) was ordered in pcDNA3.1 with XhoI/XbaI cloning sites (Genscript Biotech). The plasmid was digested and inserted into the XhoI/XbaI sites of the pLV-CMV-IRES-eGFP lentiviral backbone (kindly provided by Prof ...
-
bioRxiv - Genetics 2019Quote: ... We also designed the piggyBac vector containing tetR-3xFlag-HA and obtained the plasmid synthesized by GenScript. We transfected the plasmids with Super PiggyBac Transposase Expression Vector (System Biosciences ...
-
bioRxiv - Bioengineering 2020Quote: ... The EQCi plasmids for multiplex gene repression (harboring multiple sgRNA cassettes) were constructed by GenScript (Nanjing, China).
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Microbiology 2021Quote: ... GenBank accession no. NC_004718.3) and WIV1-CoV spike (GenBank accession no. KC881007.1) expression plasmids were synthesized by Genscript and codon-optimized for human expression ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding the YpCntL protein was cloned in a pET-TEV plasmid (synthetic DNA from GenScript). After transformation ...
-
bioRxiv - Biophysics 2022Quote: ... and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues, purchased form GenScript, Piscataway, NJ) and enNTS1 (containing the full set of 10 methionine residues ...
-
bioRxiv - Cell Biology 2022Quote: ... The gRNA: ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu/) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transform into competent cell (Trelief 5a ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... to the N terminus of the DNase1L3 protein coding region and deleting the C-terminal DYK sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript), followed by insertion into the pmEGFP-N1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the C-terminal DYK sequence of the DNase1L3 protein coding sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript). The obtained sequence was then inserted into the pmEGFP-N1 vector to construct DNase1L3ΔNT-EGFP ...
-
bioRxiv - Biochemistry 2023Quote: ... All transfections were performed using full-length Rhinolophus ACE2 placed into a HDM plasmid (synthesized by GenScript). Transfection of ACE2 alleles into HEK293T cells was performed using 0.2 µg DNA and 0.15 µL Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: The plasmid DNA encoding the different A-IDP sequences in pQE80L cloning vectors was purchased from Genscript Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 S glycoprotein ectodomain (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) were cloned into pcDNA3.1+ plasmid by GenScript with the host N-terminal signal peptide sequence ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 RBD (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) spanning residues 303-415 were cloned into pcDNA3.1+ plasmid by GenScript with an N-terminal mu-phosphatase signal peptide sequence and C-terminal short linker GSG ...
-
bioRxiv - Microbiology 2023Quote: Plasmids containing partial CVB5 Faulkner (CVB5F) genome (Accession Number: AF114383) in a pUC57 vector were purchased (GenScript) and were cloned by Gibson Assembly55 using Gibson Assembly Mastermix (NEB ...
-
bioRxiv - Immunology 2024Quote: ... A plasmid encoding full length G12V-TCR in the format TCRα-T2A-TCRβ was synthesized by Genscript and cloned into pcDNA3.1 ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Biochemistry 2019Quote: Synthetic genes encoding human viperin, IRAK1 and TRAF6 (GenBank accession numbers AAL50053.1, NM145803, NM001569 respectively) were purchased from GenScript. For details see supplementary information.
-
bioRxiv - Molecular Biology 2019Quote: ... Clone OHu31338D containing the open reading frame of the human ALKBH3 in pcDNA3.1 with C-terminal FLAG tag was obtained from GenScript, U.S.A ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Biochemistry 2022Quote: ... and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.
-
bioRxiv - Immunology 2020Quote: The construct of human iNOS oxygenase domain (1284 nucleotide) and full length NOSIP (912 nucleotide) were synthesized by GenScript and cloned in pET22b expression vector ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding human ACE2 (1-615) with a 6xHis tag at C terminus was synthesized by Genscript and cloned to the vector pCMV-IRES-puro ...
-
bioRxiv - Biochemistry 2020Quote: cDNAs encoding the SARS-CoV and SARS-CoV-2 spike proteins were human codon optimized and synthesized by Genscript. cDNA encoding human ACE2 was obtained from MGC clone 47598 ...
-
bioRxiv - Genetics 2022Quote: The pancreatic isoform of human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast expression and cloned into pDONR221 (Genscript). The initial test set GCK variants were generated by Genscript ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Blots were first incubated with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) at a dilution of 1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: DNA polynucleotides encoding the opsin domains optimized for human codon usage were synthesized and cloned by GenScript (Piscataway, NJ) into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: Full-length human codon-optimized SARS-CoV-2 Spike (S) glycoprotein (NC_045512.2) in pUC57 was obtained from GenScript (MC_0101081). The plasmid was used as a PCR template to generate a cDNA encoding SARS-CoV-2 Spike with a deletion in the nucleotides encoding the C-terminal 19 amino acids (S-Δ19CT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene ...
-
bioRxiv - Microbiology 2021Quote: The human codon-optimized S gene of SARS-CoV2 (Wuhan-Hu-1 isolate, accession number MN908947.3) was obtained from GenScript. Site-directed mutagenesis was used to produce the glycan-masking S mutant genes ...