Labshake search
Citations for GenScript :
351 - 400 of 597 citations for Dengue Virus Serotype 3 NS1 Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit polyclonal antibody to Drosophila Rab6 3’UTR was acquired by immunizing the New Zealand rabbit with peptide NRLSRRSNHPLPLFC by GenScript company (Nanjing) ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Neuroscience 2020Quote: ... Purified monomer protein passed through two to three rounds of endotoxin removal (Endotoxin removal kit, GenScript) to reach a level of <0.1 EU mg-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... The experiments were performed by direct immobilization of the recombinant IL6 protein (Cat. No. Z03034, Genscript), on a CM5 biosensor chip surface (Cytiva ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Neuroscience 2021Quote: ... and a FLAG-HA tag in-frame with the sORF protein sequence was synthesized by Genscript and cloned into an FUGW overexpression vector (Addgene #14883) ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hdp1opt and Hdp1opt L27Q proteins used for the in vitro experiments were synthesized by GenScript and resuspended in water for a stock concentration of 1 mg/ml.
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2020Quote: Templates for the expression of proteins UF1 to UF6 were prepared by gene synthesis (GenScript, USA). Before synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Seven µg of total protein were loaded on an SDS-PAGE gel (GenScript, New Jersey, USA), and then transferred to a PVDF membrane as previously described [42] ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatants were incubated with 30 µl of protein A/G-coated magnetic beads (Genscript L00277) to remove the nonspecifically bound proteins for 1 hour at 4 °C with agitation ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Neuroscience 2022Quote: ... The purified proteins were made endotoxin free using the Toxineraser endotoxin removal kit (Genscript, Piscataway, NJ). For fibrillation ...
-
bioRxiv - Cell Biology 2022Quote: ... transferred to nitrocellulose membrane and the protein tags were detected by rabbit anti-BAP antibody (Genscript) and rat anti-HA antibody (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Microbiology 2023Quote: ... and the size of bands was indicated by broad multi-color pre-stained protein standard (GenScript). Edman sequencing was performed on a Shimadzu PPSQ-53A at the Iowa State University Protein Facility ...
-
bioRxiv - Cell Biology 2022Quote: M1 ubiquitinated proteins were enriched using GST-tagged UBAN-coupled Glutathione MagBeads (Genscript, Piscataway NJ, SA), as described previously 116 ...