Labshake search
Citations for GenScript :
51 - 100 of 597 citations for Dengue Virus Serotype 3 NS1 Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: VLPs were produced by transfecting T150 flasks of HEK293T cells with 8μg of vesicular stomatitis virus-G glycoprotein (VSV-G) expressing plasmid pMDG (Genscript) pMDG ...
-
bioRxiv - Microbiology 2019Quote: ... For HIV-1 GFP/Luc each flask was transfected with 2.5 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 µg pLAIΔEnv GFP/Luc ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Influenza virus hemagglutinin (A/New Yotk/392/2004, NCBI accession # YP_308839) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pfs25 was expressed and purified from a baculovirus expression system using Spodoptera frugiperda SF9 cells and P2 virus by Genscript.
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: The codon-optimized sequences for the three subunits of avian influenza A/Goose/Guangdong/1/1996 (H5N1) virus polymerases were synthesized (GenScript) and cloned into pFastBac expression plasmid for polymerase expression and structure determination ...
-
bioRxiv - Biochemistry 2022Quote: ... a linker region (DYDIPTT) and a Tobacco Etch Virus (TEV) protease site (ENLYFQG) in a pET-22b vector were purchased from Genscript. Site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... The codon-optimized gene encoding for these residues plus an engineered DNA sequence encoding for a C-terminal tobacco etch virus (TEV)-protease cleavage site (ENLYFQS) was synthesized by GenScript. This gene was then subcloned into the ampicillin-resistant ...
-
bioRxiv - Immunology 2020Quote: A full-length nucleocapsid (N) phosphoprotein nucleotide sequence (1293 base-pairs) of the SARS-CoV-2 virus was optimized and synthesized (Genscript). The synthesized sequence was cloned into a PET-30a(+ ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2020Quote: ... A second serum aliquot was tested with a surrogate virus neutralization test that detects isotype-independent RBD neutralizing antibodies (cPass, GenScript) (18) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).